ID: 954870187

View in Genome Browser
Species Human (GRCh38)
Location 3:53761883-53761905
Sequence CCACCCTACCTGGGTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954870176_954870187 16 Left 954870176 3:53761844-53761866 CCACCAGTGGACAGTATTGTTAC 0: 1
1: 0
2: 1
3: 5
4: 58
Right 954870187 3:53761883-53761905 CCACCCTACCTGGGTGCCATGGG 0: 1
1: 0
2: 1
3: 13
4: 136
954870179_954870187 -9 Left 954870179 3:53761869-53761891 CCCCTTTGGCTTTCCCACCCTAC 0: 1
1: 0
2: 1
3: 19
4: 337
Right 954870187 3:53761883-53761905 CCACCCTACCTGGGTGCCATGGG 0: 1
1: 0
2: 1
3: 13
4: 136
954870177_954870187 13 Left 954870177 3:53761847-53761869 CCAGTGGACAGTATTGTTACTTC 0: 1
1: 0
2: 0
3: 8
4: 83
Right 954870187 3:53761883-53761905 CCACCCTACCTGGGTGCCATGGG 0: 1
1: 0
2: 1
3: 13
4: 136
954870173_954870187 23 Left 954870173 3:53761837-53761859 CCCCTTTCCACCAGTGGACAGTA 0: 1
1: 0
2: 1
3: 12
4: 134
Right 954870187 3:53761883-53761905 CCACCCTACCTGGGTGCCATGGG 0: 1
1: 0
2: 1
3: 13
4: 136
954870175_954870187 21 Left 954870175 3:53761839-53761861 CCTTTCCACCAGTGGACAGTATT 0: 1
1: 0
2: 0
3: 16
4: 131
Right 954870187 3:53761883-53761905 CCACCCTACCTGGGTGCCATGGG 0: 1
1: 0
2: 1
3: 13
4: 136
954870180_954870187 -10 Left 954870180 3:53761870-53761892 CCCTTTGGCTTTCCCACCCTACC 0: 1
1: 0
2: 0
3: 21
4: 253
Right 954870187 3:53761883-53761905 CCACCCTACCTGGGTGCCATGGG 0: 1
1: 0
2: 1
3: 13
4: 136
954870174_954870187 22 Left 954870174 3:53761838-53761860 CCCTTTCCACCAGTGGACAGTAT 0: 1
1: 0
2: 0
3: 12
4: 126
Right 954870187 3:53761883-53761905 CCACCCTACCTGGGTGCCATGGG 0: 1
1: 0
2: 1
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954870187 Original CRISPR CCACCCTACCTGGGTGCCAT GGG Intronic
900310884 1:2032615-2032637 CAACCCTCCCTGGCTGCCCTGGG - Intergenic
900641592 1:3690327-3690349 GCGCCCCACCTGGGTGCCAAGGG + Intronic
903740346 1:25555055-25555077 ACTTCCTACCTGGGTGACATTGG + Intronic
904593334 1:31627476-31627498 CCACCCTAACCAGGTGCCAAGGG + Intronic
906198685 1:43946038-43946060 CCACCCTGTCTGTGTGCCAGGGG + Intergenic
906331000 1:44884124-44884146 CCACCGCACCTGGCTGCCAGTGG + Intronic
906712334 1:47940216-47940238 CCATTCTACCTGGGAGCCAGGGG - Intronic
908247841 1:62242074-62242096 TCACCATACCTGGCTCCCATGGG - Intronic
920298866 1:204976324-204976346 CCAACCTACCTTGGGGTCATGGG + Intronic
920547173 1:206827856-206827878 ACACCCCACCTGGGTGTCTTTGG + Intronic
1066401479 10:35080924-35080946 CCACCACACCTGGGTGCAAATGG - Intronic
1067054905 10:43044756-43044778 CTACCCGCCCTGGGTGCCACGGG + Intergenic
1067169437 10:43894401-43894423 CCACCCTACCCAGCTGCCACAGG + Intergenic
1070263700 10:74882008-74882030 GCACCCTTGGTGGGTGCCATGGG + Intronic
1071510955 10:86262361-86262383 CCTCCCTTCCTGGGTGCCCAAGG - Intronic
1073009564 10:100348686-100348708 CCCCTCTACCTGGGAGGCATGGG + Intronic
1073053636 10:100685496-100685518 CCACCTGACCTGTGTGGCATAGG + Intergenic
1073471696 10:103726434-103726456 CCACCCTCCGTGGGTGCCTGTGG - Intronic
1074979753 10:118610073-118610095 TCACCACACCTGGATGCCATGGG + Intergenic
1075028963 10:119008243-119008265 CCACCACACCTGGCTGCCTTTGG + Intergenic
1076594847 10:131619071-131619093 CCAGACTACCTGTGGGCCATGGG + Intergenic
1077532353 11:3103211-3103233 CCACCCTCCCTGGCTGGCAGGGG + Intronic
1078662378 11:13297745-13297767 CCATCCTAGCTGAGTGACATTGG + Intronic
1082086530 11:48054895-48054917 CCACCATGCCTGGCTGCCAGCGG - Intronic
1083594118 11:63910908-63910930 CCACCTTGCCTGGGTGCCCCGGG - Exonic
1083868376 11:65471281-65471303 CCACCGTACCTGGCTGGCTTTGG + Intergenic
1084434826 11:69132563-69132585 CCAGCCTCCCTGGGTGGCACTGG + Intergenic
1084556995 11:69881306-69881328 CCACCCCATCTGGGTGCCACTGG + Intergenic
1089118942 11:116118339-116118361 TCAGCTTCCCTGGGTGCCATAGG + Intergenic
1089457304 11:118633137-118633159 CAGCCCTACCTGGGTGGCACTGG - Intronic
1089578016 11:119460343-119460365 CCACCCCACCTGAGTGCGCTGGG - Intergenic
1089593488 11:119560046-119560068 CATCCCTTCCTGGGAGCCATGGG - Intergenic
1090422303 11:126583846-126583868 CCTCCCTACCTGGCTGCCTCGGG - Intronic
1101770233 12:107743052-107743074 CCACCATGCCTGGCTGCCTTGGG + Intronic
1102460129 12:113094934-113094956 CCAACCCACCTTGTTGCCATTGG - Exonic
1104299132 12:127548024-127548046 CCTCCCTACCTGGGTCCCGGAGG - Intergenic
1107879028 13:44817158-44817180 ACACCTTCCCAGGGTGCCATTGG + Intergenic
1109532943 13:63676781-63676803 CCAGCCTTCCTGGGTGACTTTGG - Intergenic
1110813574 13:79837652-79837674 CCTGCCTGCCTGGGTGCCAGTGG + Intergenic
1111743224 13:92231678-92231700 CCACCTTGCCTGGCTGTCATTGG - Intronic
1112181231 13:97083206-97083228 CTTCCCAACCTGGGTGCCAATGG + Intergenic
1112186539 13:97133381-97133403 CCACTCACCCTGGGTTCCATCGG + Intergenic
1114235782 14:20822596-20822618 CCACTGTACCTGGCTGGCATTGG - Intergenic
1120374063 14:83677999-83678021 CCACCGCACCTGGCTGACATTGG - Intergenic
1121141142 14:91543543-91543565 GCACCCTACCTTGGTGTCAGAGG - Intergenic
1122233734 14:100320490-100320512 CCACCTATTCTGGGTGCCATGGG + Intergenic
1124186204 15:27531568-27531590 TCACCCTCCATGGCTGCCATTGG + Intronic
1124512694 15:30340421-30340443 CAAGCCTAGCTGGCTGCCATGGG - Intergenic
1124711237 15:32014141-32014163 CCATTCTTCCTGGGTGCCAGAGG - Intergenic
1124730221 15:32190329-32190351 CAAGCCTAGCTGGCTGCCATGGG + Intergenic
1125503508 15:40253487-40253509 CCAGCCTACCGTGGGGCCATGGG - Intronic
1125513992 15:40307893-40307915 CCACCCGCCCTGCCTGCCATGGG + Exonic
1128794807 15:70458545-70458567 GCACCCTGCCTGGGTGACAGAGG + Intergenic
1129161195 15:73748868-73748890 CTCCCCCAGCTGGGTGCCATTGG + Intronic
1131019588 15:89087362-89087384 CCACCCTACCAAGGCCCCATAGG - Intergenic
1135393123 16:22110620-22110642 CCTCCCTCTCTGGGTGCCACAGG + Intronic
1136395795 16:29991782-29991804 CCTCCCTACCATGGTGCCAGGGG + Intronic
1141102670 16:81209385-81209407 CAAGCCTACCTGGGAGCCAGTGG - Intergenic
1141336353 16:83158805-83158827 CCGCCCTTCCTGGCTACCATGGG - Intronic
1141469827 16:84230741-84230763 GCACCTTACTTGGTTGCCATAGG + Intronic
1142259050 16:89033870-89033892 ACACGCTCCCTGGGTGCCCTCGG - Intergenic
1142342550 16:89533038-89533060 CCAGCCTGCCTGGGTGACAGAGG + Intronic
1146460113 17:33039469-33039491 CCACCTTAGCTGGGGGACATTGG + Intronic
1146573642 17:33973684-33973706 TCACCCCACCAGGCTGCCATGGG + Intronic
1147961081 17:44167997-44168019 CTACCCTACGTGAGTGGCATGGG + Intergenic
1151229896 17:72677069-72677091 TCACCAAACCTGGGTGCCTTGGG + Intronic
1151674411 17:75590170-75590192 CCACCCTTCCCCGGTGCCAAGGG + Intergenic
1152263271 17:79278557-79278579 CCACCCTGCCTGTGTGCTGTGGG + Intronic
1152631831 17:81413980-81414002 GCAGCCCACCTGGGTGCCCTTGG + Intronic
1153781194 18:8496236-8496258 CCAGCCTCCCTGTGTGCCCTGGG + Intergenic
1160842294 19:1151491-1151513 CCACCCCACAGGGGTGCCATGGG + Intronic
1160938501 19:1609124-1609146 CCAGCCGCCCTGGGAGCCATGGG + Intergenic
1162745418 19:12795253-12795275 CCAGCCTGCCTGGGTGACAGAGG - Intronic
1166893145 19:46006790-46006812 TCACCTTGCCTGGGTGCCAGGGG - Intronic
1167133307 19:47601538-47601560 CCACCCTGCCTGGCTGGCCTTGG + Intergenic
1167559086 19:50214812-50214834 TCATCCTACCTGGGAGCCCTAGG - Intronic
925292137 2:2755100-2755122 CCACCCTTCCTGGGGGACTTTGG + Intergenic
925366236 2:3313982-3314004 CCACCCTCCCCGGGTCCCAGCGG - Intronic
928695505 2:33845548-33845570 CCACCGTGCCTGGGTGCTTTTGG + Intergenic
929795436 2:45055267-45055289 CCACCCTTCATGAGTGCCAATGG + Intergenic
933947756 2:87301517-87301539 CCAGCGTGCCTGGGTGCCAAGGG + Intergenic
936332446 2:111560056-111560078 CCAGCGTGCCTGGGTGCCAAGGG - Intergenic
937007959 2:118535425-118535447 CCACCCTACCTATGTCCCATGGG - Intergenic
938232060 2:129669613-129669635 CCACCCTACCTGGGGACCCCAGG - Intergenic
938721279 2:134069265-134069287 CCACCATGCCTGGCTGCCACTGG - Intergenic
941684020 2:168429219-168429241 ACTTCCTAACTGGGTGCCATTGG + Intergenic
948079027 2:235190367-235190389 CCACGCCACCTGGGTGTCACAGG + Intergenic
948567766 2:238897442-238897464 CCACCCTTGCTGGGTGCTGTAGG - Intronic
1169258246 20:4115390-4115412 CCACCCCACCTGGCTGCCAAGGG + Intergenic
1171294991 20:24009524-24009546 CCACCATAGCTCTGTGCCATAGG + Intergenic
1172700131 20:36848203-36848225 CTACCCTCCTTGGGTGGCATAGG - Intronic
1172833882 20:37860023-37860045 CCCTCCTACCTGGGGGACATTGG - Exonic
1177175596 21:17698131-17698153 CCACCGTACCTGGCTGCTATTGG + Intergenic
1179282891 21:39950264-39950286 CCTCCCTACCTTGAAGCCATGGG - Intergenic
1180196025 21:46194773-46194795 CCACCCTACCTAAGGGCCATGGG + Intronic
1180706222 22:17811604-17811626 CCTGCCTACGTGGGTGCCAAGGG + Intronic
1180981072 22:19878256-19878278 GCACCCTGCCTGGGAGGCATGGG + Intronic
1184669714 22:46006380-46006402 CCACCCTCTCTGGGAGCCCTGGG - Intergenic
950750250 3:15122781-15122803 CCACCCTAGTTGAGAGCCATTGG + Intergenic
951264893 3:20553188-20553210 CTGCCCTCCCTGGGTGCCCTGGG - Intergenic
952946494 3:38481217-38481239 CCACCCTACCTGGGGTGCAGAGG - Intronic
954329609 3:49882653-49882675 CCACCGGACCTGGGTTCCATAGG - Intergenic
954630651 3:52046080-52046102 CCAGCCTACCTGAGAGCCCTGGG - Intergenic
954870187 3:53761883-53761905 CCACCCTACCTGGGTGCCATGGG + Intronic
955518951 3:59755693-59755715 CCTCCCTACCTGGGTGCCCCAGG - Intronic
961004461 3:123395585-123395607 CCACCATGCCTGGCTGACATGGG - Intronic
962041597 3:131713037-131713059 CCACCCTATCAGTGTGCCCTGGG - Intronic
966302879 3:178498355-178498377 CCACTCTACTTAGGTGCCAGCGG + Intronic
967789284 3:193529998-193530020 CAACCCAACTGGGGTGCCATGGG - Intronic
968704938 4:2073359-2073381 TCACCCCAGCTGGGGGCCATGGG + Intronic
968789569 4:2650304-2650326 CCACCCTGCGTGGGTGCCATGGG - Intronic
969101007 4:4768311-4768333 CCACCCTTCCTTGATGACATGGG - Intergenic
972662454 4:41129420-41129442 CTCCCCTACCTGTGTGCCTTGGG + Intronic
978248600 4:106604425-106604447 ACAAACAACCTGGGTGCCATGGG - Intergenic
978869700 4:113560719-113560741 CCAGCCTTCCTGGCTGGCATGGG - Intronic
980646191 4:135644707-135644729 CCACTCTACCTGGGAGAAATTGG - Intergenic
982117409 4:152109119-152109141 CCACCCTTTCTGGATGCCAGGGG - Intergenic
986082509 5:4409478-4409500 GCACCCTACCTGTGCCCCATGGG + Intergenic
986345046 5:6826988-6827010 CCATCCTACCAGGGTGCCCCCGG + Intergenic
989164635 5:38422378-38422400 TCACCCTTCCTGGCTGCCCTGGG + Intronic
994119896 5:96101968-96101990 CACCCCAACCTGGGTGCCACAGG - Intergenic
998506498 5:142676598-142676620 CTACCCTACCAGAGTGCCACAGG + Intronic
998849516 5:146339863-146339885 CCACACCACCTGGGCGCCATGGG + Exonic
999389427 5:151179560-151179582 GCACCCTCACTGGGTGCCACTGG - Intergenic
1001921293 5:175602035-175602057 CCACCATGCCTGGCTACCATAGG + Intergenic
1002085313 5:176771247-176771269 CCACCCAGCCTGGGTTACATGGG + Intergenic
1002085324 5:176771284-176771306 CCACCCTGCCTGGGTTACATGGG + Intergenic
1002085334 5:176771321-176771343 CCACCCTGCCTGGGTTACATGGG + Intergenic
1002581093 5:180209626-180209648 CCACCCTCCCTGGGGGCCACGGG - Intergenic
1004336541 6:14769568-14769590 CCAGCCTACCAGGATGCTATGGG + Intergenic
1005972299 6:30770906-30770928 CCACTGTACCTGGGGGCCTTTGG + Intergenic
1006511919 6:34526139-34526161 CAAGCCTCCCTGGGTCCCATCGG + Intronic
1011016810 6:82765749-82765771 CCACTCTAGCTGTGTGACATTGG + Intergenic
1017525188 6:155236373-155236395 CCACCATGCCTGGCTGTCATGGG - Intronic
1018790765 6:167145799-167145821 CCACCCTTCATGGGTGGCAGAGG - Intergenic
1027780037 7:82508440-82508462 CCTCCCTCCCTGGGTGCCGCTGG - Intergenic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1033120327 7:138662421-138662443 CCAACCTACTTGGGTGCTCTGGG + Intronic
1035696921 8:1605057-1605079 GCAGCCAACCTCGGTGCCATCGG + Intronic
1036822200 8:11950152-11950174 CCATCCTGCCTGTGTGCCCTGGG - Intergenic
1038443652 8:27588303-27588325 CAGCCCTACCTGGGTGCAGTGGG - Intergenic
1044988683 8:97776350-97776372 CCACACCACCTGGGCGCCAAGGG - Intronic
1045754262 8:105523642-105523664 CCCCCCTACCTCCGTGCCAGTGG + Intronic
1049039398 8:140100599-140100621 CCTCCCTTCCTGGGCACCATTGG + Intronic
1049218449 8:141418117-141418139 GCCCCCTCCCTGGGTGCCAGCGG - Intronic
1049370029 8:142259971-142259993 CCACCCTGCCCAGGTGCCCTCGG + Intronic
1061722725 9:132562983-132563005 CCACCCCACCTGGCCGCAATTGG + Intronic
1062188020 9:135228932-135228954 CCACGCTACCTGGTGGCCATCGG - Intergenic
1200247157 X:154532309-154532331 CCTCCCTCCCTGTGTGCCACCGG - Intronic
1200251899 X:154558375-154558397 CCCCCAAACCTGGGTGCCCTAGG - Intronic
1200265868 X:154646041-154646063 CCCCCAAACCTGGGTGCCCTAGG + Intergenic