ID: 954870212

View in Genome Browser
Species Human (GRCh38)
Location 3:53762014-53762036
Sequence GAGGGAGTCAAACGTGTTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954870212_954870216 5 Left 954870212 3:53762014-53762036 CCTGGAACACGTTTGACTCCCTC 0: 1
1: 0
2: 0
3: 9
4: 64
Right 954870216 3:53762042-53762064 AATCGGCAGCATTATAGACGTGG 0: 1
1: 0
2: 0
3: 1
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954870212 Original CRISPR GAGGGAGTCAAACGTGTTCC AGG (reversed) Exonic
907320861 1:53601469-53601491 TAAGGAGTCAATCATGTTCCAGG - Intronic
907865199 1:58392557-58392579 GAGAGACTGAAACGTGTTCCTGG - Intronic
909545045 1:76837251-76837273 GAGGGAGATAATCGTGTTCCTGG + Intergenic
910690137 1:89957200-89957222 GAGGGTGTCAAAGCTGTCCCTGG + Intergenic
914441800 1:147714177-147714199 GAGGAAGTCAAAGATTTTCCTGG - Intergenic
914721566 1:150293665-150293687 GAGGGCGAGAAACGTGTTTCGGG + Intergenic
915172275 1:153986332-153986354 GAGGGAGGAAAACTTCTTCCTGG - Exonic
921100767 1:211927292-211927314 GAGGGAGTCAAAAGGGTTTCTGG - Intergenic
922217997 1:223536302-223536324 GAGGGAGTCAAGAGTGATCGGGG + Intergenic
1063221839 10:3976023-3976045 GAGGGAGAGACAAGTGTTCCGGG - Intergenic
1063494618 10:6495373-6495395 GGGAGAGTCCAATGTGTTCCAGG - Intronic
1066280503 10:33912950-33912972 GAGGGAGAAAAAAGTGTTGCTGG + Intergenic
1067557998 10:47285649-47285671 GAGGGAGACAAACTTGATCCTGG + Intergenic
1071770867 10:88727821-88727843 GAAGGAGGCAAACTTGTTCAGGG - Intronic
1078413859 11:11149370-11149392 GAAAGAGCAAAACGTGTTCCAGG - Intergenic
1083274623 11:61589635-61589657 GAGGAAGTCAAAAGTCATCCTGG - Intergenic
1083518104 11:63279250-63279272 GAGGGATTCAAGCATGTTCAGGG + Intronic
1087957274 11:104303978-104304000 GAGGGAGAGAAGGGTGTTCCAGG - Intergenic
1090132701 11:124161229-124161251 AAGGGAGACAAACGTTTGCCTGG + Intergenic
1090711113 11:129386623-129386645 TAGGGAGTAAAATGTGGTCCAGG - Intronic
1096670273 12:53194302-53194324 GAGGGAGTGAAGAGTGTTCAAGG + Exonic
1113050560 13:106206824-106206846 GAGGCAGATAAACATGTTCCAGG - Intergenic
1117343545 14:54811561-54811583 GATGGAGCCAGCCGTGTTCCAGG + Intergenic
1121645239 14:95514065-95514087 GAGGGACTCAAATGTGTTCGTGG - Intergenic
1123821984 15:24039871-24039893 GATGGAGACAAAAGTGATCCTGG + Intergenic
1127388262 15:58484920-58484942 GAAGGAGTGCAATGTGTTCCAGG + Intronic
1131345563 15:91644681-91644703 GAGGGAGTCAAAAGTATTTGTGG + Intergenic
1134304632 16:13021158-13021180 GAGGGAGGCAAAATTGTCCCTGG - Intronic
1135120604 16:19763035-19763057 GAGGGAGTCAAAAGTTTTAGAGG - Intronic
1142574627 17:898354-898376 GATGGGATCAAAGGTGTTCCAGG - Intronic
1143584349 17:7843953-7843975 GAGGAAGTGAAACGAGTTCTGGG + Intronic
1144734031 17:17544974-17544996 GAGGGAGTCCAAGGTGGGCCCGG + Intronic
1146962872 17:36999849-36999871 AAGGGAGGCTAGCGTGTTCCAGG + Intronic
1151180045 17:72320725-72320747 GAGGGAGAGAAACGAGATCCAGG + Intergenic
1151471690 17:74322332-74322354 GAGGGACAGAAACGGGTTCCAGG + Intergenic
925749971 2:7079296-7079318 CAGGAAGTCAAAGGTGTTCGAGG - Intergenic
928637859 2:33266386-33266408 GAGGGAGGCAGACAGGTTCCTGG + Intronic
929747583 2:44674932-44674954 GAGGGAGTCACACCTTTTTCAGG - Intronic
929762976 2:44821272-44821294 GAGGGTGTCCAAGGTCTTCCTGG - Intergenic
935451120 2:103210731-103210753 GAGGGAGTTGGACGTGTGCCAGG + Intergenic
940582630 2:155601024-155601046 GAGGGAGACAGACAGGTTCCTGG - Intergenic
942795938 2:179819353-179819375 GAGGGAGGCCACTGTGTTCCAGG - Intronic
947833302 2:233157242-233157264 GAGAGAGAGAAACGTATTCCTGG + Intronic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1179436102 21:41363206-41363228 AAGGGAGTCAAAAGTGCTTCAGG - Intronic
1182472169 22:30555307-30555329 GTGGGAGTCCAGCATGTTCCAGG + Exonic
949398979 3:3645752-3645774 GAGAGAGTCAAAAGTGTGCTTGG - Intergenic
950079805 3:10213272-10213294 GAGTGAGGCAGACGTGGTCCAGG + Exonic
954870212 3:53762014-53762036 GAGGGAGTCAAACGTGTTCCAGG - Exonic
956998119 3:74851407-74851429 GAGGGAGTCATACATGTGACCGG - Intergenic
958688532 3:97430217-97430239 GAGGGTGTCAAAAATGTTTCTGG - Intronic
968066002 3:195759990-195760012 GAGGGAGTGAAACCTCTTCACGG + Intronic
970440297 4:16075975-16075997 GGGGAAGGCAAGCGTGTTCCTGG + Exonic
974686848 4:65242195-65242217 GCGGGAGGCAAACAGGTTCCTGG - Intergenic
989168856 5:38455749-38455771 TAGGGAGTCAACCGTGAACCTGG - Intronic
994048100 5:95331679-95331701 GAGGGAGTCCAAGTTGTTCCAGG + Intergenic
1006447531 6:34088112-34088134 AAAGGAGTGAAACGTGCTCCTGG - Intronic
1018207196 6:161446553-161446575 GAGGAATTCATACCTGTTCCTGG + Intronic
1019235663 6:170610147-170610169 GAGGGACACATGCGTGTTCCAGG + Intergenic
1021231521 7:18091307-18091329 GAGAGAGTATAACGTGTTTCTGG + Intronic
1024329083 7:48138908-48138930 GAGGGCGTCACACGTGAACCAGG + Intergenic
1027730767 7:81869588-81869610 TAAGGTGTCAAACGTTTTCCAGG - Intergenic
1029973804 7:104814607-104814629 GAGGGAGGCAGACAGGTTCCTGG - Intronic
1035515496 8:229118-229140 GAGGGACACATGCGTGTTCCGGG + Intergenic
1036787204 8:11695992-11696014 ATGGGAGTCAAACGTGTACCAGG + Intronic
1037912390 8:22751410-22751432 TAGGGTCTCACACGTGTTCCTGG - Intronic
1039612977 8:38933593-38933615 GAGGGAGACCAACGGGCTCCAGG - Intronic
1042676410 8:71326807-71326829 CAGGGAGACCAACGTTTTCCTGG - Intronic
1044550189 8:93503620-93503642 GTGGGAGTCAACAGTGTTCCTGG - Intergenic
1059889496 9:118785526-118785548 TAGGGAGCCAAACGAGTCCCTGG + Intergenic
1061852034 9:133422057-133422079 GAGGGAGTCAGCCGAGGTCCTGG + Exonic
1185938271 X:4283657-4283679 CAGGGATTCAAACATGTTCATGG - Intergenic
1190327194 X:49213864-49213886 AAGAGCGTCAAACGTGTTCCAGG + Exonic
1194452925 X:94066881-94066903 GAGAGAATTAAAGGTGTTCCAGG - Intergenic