ID: 954871883

View in Genome Browser
Species Human (GRCh38)
Location 3:53773518-53773540
Sequence GCAGAGATCTACAGCCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954871883_954871888 12 Left 954871883 3:53773518-53773540 CCCAGGTGGCTGTAGATCTCTGC 0: 1
1: 0
2: 1
3: 13
4: 149
Right 954871888 3:53773553-53773575 TGCAGATTCTCCACGTGTGCAGG 0: 1
1: 0
2: 1
3: 7
4: 106
954871883_954871890 26 Left 954871883 3:53773518-53773540 CCCAGGTGGCTGTAGATCTCTGC 0: 1
1: 0
2: 1
3: 13
4: 149
Right 954871890 3:53773567-53773589 GTGTGCAGGTGCTGTCTTTCAGG 0: 1
1: 0
2: 2
3: 16
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954871883 Original CRISPR GCAGAGATCTACAGCCACCT GGG (reversed) Intronic
900246381 1:1638099-1638121 ACAGCCACCTACAGCCACCTGGG + Intronic
900257610 1:1705241-1705263 ACAGCCACCTACAGCCACCTGGG + Intronic
901121894 1:6902117-6902139 GCAGAATGCTACAGCCACTTTGG + Intronic
905272521 1:36796255-36796277 ACAGAGATCTGCAGCCTCCTGGG + Exonic
905951020 1:41950611-41950633 GCTGTGAGCTACTGCCACCTGGG + Intronic
906580840 1:46934197-46934219 GAGGAGATCCACAGCCTCCTGGG - Exonic
907497291 1:54853518-54853540 GCAGAGCTCTACATCGACATTGG - Exonic
911351054 1:96756061-96756083 GCAGAGTGGTACAGCCACTTTGG + Intronic
913177646 1:116289584-116289606 GCAGAGAGGTACAGACACCTTGG + Intergenic
919061486 1:192639377-192639399 ACAGAGATTTACAGACATCTGGG - Intronic
924015201 1:239713719-239713741 GCAGAGGTCTCCAGCAAACTGGG - Intronic
924163027 1:241253412-241253434 ACAGAGATCTATGGCCACCTGGG - Intronic
1063086601 10:2823787-2823809 GGAAAGGTCTGCAGCCACCTGGG - Intergenic
1063457638 10:6195508-6195530 GCAGACATGGCCAGCCACCTAGG - Intronic
1064602571 10:17008485-17008507 GCTTAGCTCTGCAGCCACCTTGG + Intronic
1064815903 10:19261812-19261834 GCAGTGTTCTCCAGCAACCTGGG + Intronic
1072463389 10:95640905-95640927 GCAGAGCTCTGAAGCCAACTAGG - Intronic
1074256753 10:111810748-111810770 AGAGAGATGTGCAGCCACCTGGG + Intergenic
1074734329 10:116412797-116412819 GTAGAGAACAACAGCAACCTAGG - Intergenic
1075896985 10:126004965-126004987 GCAGAGCTGTACAGCCTCCCAGG - Exonic
1076461899 10:130653561-130653583 GCAGAGGTGTGCAGCCTCCTCGG - Intergenic
1078900988 11:15642676-15642698 GCAGAGGCCTACAGCATCCTGGG + Intergenic
1080422396 11:32122246-32122268 GCAGTGATCTGCAGCCAAGTGGG - Intergenic
1081899079 11:46612471-46612493 TCAGAGCTGTACAGTCACCTTGG + Intronic
1086313017 11:85557246-85557268 GCAGAGATCTTTCACCACCTTGG - Intronic
1086685862 11:89732438-89732460 GGAGAGAGCTAGAGCCAACTTGG - Intergenic
1088935459 11:114395396-114395418 GCAGAGAACAGCAACCACCTGGG + Intronic
1089601622 11:119619185-119619207 GCAGAGATCTACAGGAACAGAGG + Intergenic
1090945716 11:131427837-131427859 GCAGAGGAATACAGCGACCTGGG - Intronic
1096750764 12:53757399-53757421 ACAGAGAGCTACAGCTGCCTTGG + Intergenic
1097258553 12:57699247-57699269 CCAGAGATCCACAGCCCCCTTGG - Intronic
1098660590 12:73088103-73088125 GCAAATTTCTACAGCCAGCTTGG + Intergenic
1102908863 12:116697379-116697401 ACAGAAATCAAGAGCCACCTTGG + Intergenic
1104312955 12:127670869-127670891 GCTGAGATCTGCTTCCACCTTGG - Intergenic
1104649984 12:130524472-130524494 GCAGAGAGCTACAGACAGCTGGG + Intronic
1105835924 13:24211961-24211983 TCAGAGAGCTCCAGCCACGTGGG - Intronic
1105935190 13:25091861-25091883 ACAGAGCTCCACAGCCACCAAGG + Intergenic
1106181516 13:27373445-27373467 GCAGAGAGGTTAAGCCACCTGGG - Intergenic
1114728644 14:24966664-24966686 GAAGAGATCTAGAACCACCAAGG + Intronic
1115067327 14:29279918-29279940 TCACAGATATACAGCCATCTAGG - Intergenic
1117345543 14:54828156-54828178 GCAAAGAGCTCCAGCCATCTGGG - Intergenic
1118847922 14:69562031-69562053 GCAGAACTCTAGACCCACCTAGG + Intergenic
1120886298 14:89454322-89454344 GCAGACAGCCACAGCCACCCTGG - Intronic
1121713811 14:96058668-96058690 GCAGAAAGCAGCAGCCACCTGGG + Intronic
1122173809 14:99901241-99901263 TCAGACATCTCCAGCCACATGGG + Intronic
1123989278 15:25671392-25671414 ACAGAGATTTATGGCCACCTGGG + Intergenic
1124653367 15:31488593-31488615 GCAGAGAAGCACAGCCACCTTGG + Intronic
1125754707 15:42055618-42055640 CCAGAGATCTGAAGCCACATGGG + Intergenic
1126313679 15:47344579-47344601 CCTGAGAACTTCAGCCACCTTGG - Intronic
1126669048 15:51099701-51099723 GCAGAGCTCAACAGTCACTTAGG - Intronic
1130831257 15:87603170-87603192 GGAGACAGCTACAGCCACCAAGG + Intergenic
1131872637 15:96777728-96777750 GCAGAGAGCCACAGCCACAGGGG - Intergenic
1132368317 15:101274574-101274596 GCCGAGGTCTCCAGTCACCTGGG + Exonic
1132907732 16:2291752-2291774 GCAGTGATAAACAGTCACCTCGG - Intronic
1133417601 16:5618630-5618652 ACAAAAATCTACAGCCAGCTGGG - Intergenic
1139576547 16:67846023-67846045 AAAGAGATCTGCAGCCAACTTGG - Intronic
1141061263 16:80873587-80873609 GCAAAGTGCTACAGCCACTTTGG + Intergenic
1142170208 16:88617892-88617914 GCAGAGATCTTGAGACTCCTGGG - Intronic
1142994860 17:3754631-3754653 GCTGAGTACTACAGCCTCCTGGG - Intronic
1146892535 17:36515239-36515261 CCAGAGACCTGCAGCCACCTTGG - Intronic
1147380987 17:40056139-40056161 GCAGAGAATTACAGCGCCCTGGG + Intronic
1147609072 17:41791058-41791080 GCAGAAAGCTAGAGGCACCTTGG + Intergenic
1149155800 17:53629031-53629053 GCAGAGAACTACAGCTGGCTGGG + Intergenic
1150274722 17:63889263-63889285 GCAGGGATCCACAGCCATTTTGG + Intergenic
1150276858 17:63904067-63904089 GCAGGGATCCACAGCCATTTTGG + Intergenic
1152510249 17:80781975-80781997 TCAGAGCTCTGGAGCCACCTCGG + Intronic
1152902454 17:82950866-82950888 GCACAGATGTGCTGCCACCTGGG + Intronic
1154247678 18:12714123-12714145 GCACAGATATACAGCCTCATAGG - Intronic
1154267419 18:12891177-12891199 GCAGAGCCCTGCAGACACCTTGG + Intronic
1155543353 18:26888931-26888953 GCACAGATGTACACCCACCCTGG + Intergenic
1156448871 18:37255199-37255221 ACAGAGATGCACAGCCACCCGGG + Intronic
1157661437 18:49448506-49448528 GCAGAGGACTACAGCCACTTGGG + Intronic
1157920466 18:51708526-51708548 GCAGATTTTTAAAGCCACCTTGG - Intergenic
1158016653 18:52791592-52791614 GCAGAGGACTAGAGCCACTTGGG - Intronic
1158834951 18:61321011-61321033 CCAGAAATCTACAGACAGCTTGG - Intergenic
1159174383 18:64814624-64814646 GCAGAGGACTAGAGCCACTTGGG + Intergenic
1162506925 19:11090901-11090923 GCCGAGATCTTCAGCCACGGTGG + Intronic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1163557469 19:18000946-18000968 GCTGAGATCTGCGGCCGCCTCGG + Intergenic
1164961605 19:32435811-32435833 ACAGAGATCCACAGCCACAGAGG - Intronic
1166366648 19:42281387-42281409 GAAGACATCAACAGCCACCCGGG - Intronic
1167318193 19:48778708-48778730 GCAGACATCAACAGCCAGCGAGG + Intergenic
926088533 2:10035339-10035361 GCAGTGATGGACAACCACCTGGG - Intergenic
927469418 2:23361588-23361610 GCAGAAATGCACAGCCACCCTGG - Intergenic
927757444 2:25720330-25720352 GCTGTGGTTTACAGCCACCTGGG + Intergenic
928252921 2:29697507-29697529 GCAAAGTTCTTCAGCCACTTTGG - Intronic
929752200 2:44727320-44727342 GCAGAGATCTTCTACCTCCTTGG + Intronic
931538232 2:63301579-63301601 GCAGAGAACTAGAGCCACTTGGG + Intronic
933161938 2:79035097-79035119 ACAGACATCTACAGGGACCTGGG + Intergenic
933353602 2:81188391-81188413 TCAGAGATCCACAGCTACCCGGG - Intergenic
934519116 2:95008193-95008215 GCAGACCTCTACAGCGACCAAGG - Intergenic
934755310 2:96820470-96820492 GCAGAGAGCCTCAGCCTCCTAGG + Intronic
938610489 2:132942835-132942857 GCAGAGATAAAAAGGCACCTAGG - Intronic
942675046 2:178417775-178417797 GCAGAAATCTAGGGCCACCAGGG + Intergenic
943842822 2:192602236-192602258 GAAGAGATGTACAGCCCCATGGG + Intergenic
944258306 2:197648061-197648083 ACAGAGGTCAACAGCCAACTAGG - Intronic
945854307 2:215049608-215049630 TCAAAGATCTACACTCACCTGGG + Exonic
1170437540 20:16345978-16346000 GCAGAGCTCTGCAGCCAGGTGGG + Intronic
1170498021 20:16945827-16945849 GCAAAGAGCTGCAGCCACTTGGG - Intergenic
1171151731 20:22833471-22833493 GCAGAAAGGTCCAGCCACCTTGG + Intergenic
1173443101 20:43095489-43095511 GCAGACATGTCCAGCCACATGGG - Intronic
1176216728 20:63951611-63951633 GCAGGGACCTGCAGCCACCCAGG + Intronic
1177294388 21:19156031-19156053 GCAGAGATCTTCCACCTCCTTGG + Intergenic
1183117309 22:35701933-35701955 GAAGAGATGTACAGCCCCCATGG - Intergenic
950115510 3:10448186-10448208 CCAGATATCTACCACCACCTGGG - Intronic
950147682 3:10663577-10663599 GCAGAGAACCAAAACCACCTGGG - Intronic
950336345 3:12196927-12196949 GCAGAAAGCTACAGCCACCTGGG + Intergenic
951349799 3:21593040-21593062 CCACACATCTACAGCCACCCGGG + Intronic
954214556 3:49117143-49117165 GCAGAGATGCACAGCCCTCTTGG + Exonic
954871883 3:53773518-53773540 GCAGAGATCTACAGCCACCTGGG - Intronic
961360246 3:126362505-126362527 GGAGAGATTTACAGACACATGGG - Intergenic
961452012 3:127006495-127006517 GCAGCCATACACAGCCACCTGGG - Intronic
966583292 3:181592603-181592625 GCAGAGATCTTTCGCCTCCTTGG + Intergenic
967134840 3:186504491-186504513 GCTGAGAGCTACAGCCATTTTGG - Intergenic
972673605 4:41237949-41237971 GCAGAGGTCTGCAGGCACCTTGG - Intergenic
974180069 4:58373036-58373058 GCAGAGATCTTCAACCTCCTTGG + Intergenic
978019154 4:103786755-103786777 GCAGAGGACTAGAGCCACTTGGG + Intergenic
979164175 4:117505355-117505377 GCAGAAATTTACAGTCACTTGGG - Intergenic
979615950 4:122742982-122743004 ACAGAGAATTACCGCCACCTGGG + Exonic
980642354 4:135596846-135596868 GCAGAGAACTAGAGCTACTTGGG + Intergenic
982361010 4:154519076-154519098 GCAGCTCTCTACAGCCACCATGG - Intergenic
982887558 4:160800931-160800953 GCAGAGATCTTCTACCTCCTTGG - Intergenic
984716028 4:182926031-182926053 GCTGTGATCCAAAGCCACCTTGG + Intergenic
985096820 4:186421005-186421027 GCAGAGGTGTGCAGCCACCGTGG - Intergenic
986931105 5:12822867-12822889 GCAGAGATCTTTTGCCCCCTCGG + Intergenic
990333502 5:54750093-54750115 GCAGAGATCAACTGTCACCGTGG - Intergenic
991290907 5:65033306-65033328 GCAGAGCTGTGCAGCCATCTTGG + Intergenic
992082639 5:73249459-73249481 GCACAGACATATAGCCACCTGGG + Intergenic
996322179 5:122231085-122231107 GCAAAGAGGTACAGCCACTTTGG + Intergenic
996477372 5:123936864-123936886 GCAGAGAACTAGAGCCAGTTGGG - Intergenic
997354107 5:133251390-133251412 GCAGAGAGCCAGAACCACCTTGG + Intronic
999232628 5:150070477-150070499 TCAGAGCTCTCCAGCCTCCTGGG + Exonic
1000017326 5:157289531-157289553 GCAGAGAGAAACAGCCATCTGGG - Intronic
1000264886 5:159626203-159626225 GTAGAGATCTACCACCTCCTTGG - Intergenic
1005096125 6:22118463-22118485 GAAAAGATCTACAGCCTCCTCGG - Intergenic
1006401663 6:33821359-33821381 GAAGCGGTCTACAGGCACCTGGG + Intergenic
1011149751 6:84257895-84257917 GCAGAGATTGCCACCCACCTTGG - Intergenic
1013612315 6:111806725-111806747 GCAGAGAGCTGCTGGCACCTGGG + Intronic
1016360145 6:143258946-143258968 GCAGAGGTCAACAGAGACCTTGG + Intronic
1020619043 7:10496531-10496553 GCTGAGGTCTGCAGCCACTTGGG + Intergenic
1022509209 7:30924407-30924429 GCAGAGATCGACAGACAGCCAGG + Exonic
1023836797 7:44073328-44073350 GAAGACATCTTCAGACACCTGGG - Exonic
1024425017 7:49215574-49215596 CCAGATATCTAAAGCAACCTCGG - Intergenic
1028431639 7:90753919-90753941 GCAGAGATCTTTAACCTCCTTGG - Intronic
1028907207 7:96168187-96168209 TCAGAGATCTAAAGGGACCTGGG + Intronic
1029259155 7:99289796-99289818 GCAGAGATTTACAGTCAGCTGGG + Intergenic
1029920972 7:104263191-104263213 GCAAAGTGCTACAGCCACTTTGG - Intergenic
1032817583 7:135492989-135493011 GCTGGCATCTACTGCCACCTGGG - Intronic
1037909083 8:22733142-22733164 GCAGAGATCTTTAGCCCCATTGG + Intronic
1038586746 8:28796543-28796565 GGAGAGTTCTGCAGCAACCTAGG - Exonic
1039183491 8:34891887-34891909 GCAGAGGACTAGAGCCACATGGG + Intergenic
1039370655 8:36981024-36981046 GCAAAGCTGTACAGACACCTGGG - Intergenic
1044247986 8:89972124-89972146 GCAGAGATCAACATCCAACGTGG + Intronic
1045590584 8:103590383-103590405 TCAAAGATCTGCAGACACCTGGG - Intronic
1049990129 9:982339-982361 CCAGAGTTCTACTGCCATCTGGG + Intronic
1050902806 9:10967183-10967205 GAAGAGATGTACAGCCCCGTGGG + Intergenic
1055076282 9:72218526-72218548 GCAGAAAACTACAGCTGCCTAGG + Intronic
1056018178 9:82413962-82413984 GTAGAGATCTTCCACCACCTTGG - Intergenic
1056796560 9:89662697-89662719 GCAGTGATTAGCAGCCACCTGGG + Intergenic
1060704418 9:125785053-125785075 GAAAAGATGTGCAGCCACCTGGG - Intronic
1061902682 9:133681006-133681028 GCACAGATTTACTGTCACCTGGG - Intronic
1062385226 9:136306702-136306724 GGAGAGAGCAGCAGCCACCTGGG + Intronic
1062451260 9:136616724-136616746 GAAGAGGTCTCCAGCCATCTGGG + Intergenic
1192226017 X:69228452-69228474 GCAGGGATCCACAGCCACAGTGG + Intergenic