ID: 954872564

View in Genome Browser
Species Human (GRCh38)
Location 3:53778817-53778839
Sequence GAGCCTATGTGGCTTCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954872564_954872566 7 Left 954872564 3:53778817-53778839 CCTGGGAGAAGCCACATAGGCTC 0: 1
1: 0
2: 1
3: 15
4: 193
Right 954872566 3:53778847-53778869 ATGCCACAAGATGTACATGATGG 0: 1
1: 0
2: 0
3: 8
4: 114
954872564_954872569 22 Left 954872564 3:53778817-53778839 CCTGGGAGAAGCCACATAGGCTC 0: 1
1: 0
2: 1
3: 15
4: 193
Right 954872569 3:53778862-53778884 CATGATGGTCTAACTAGGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 83
954872564_954872570 30 Left 954872564 3:53778817-53778839 CCTGGGAGAAGCCACATAGGCTC 0: 1
1: 0
2: 1
3: 15
4: 193
Right 954872570 3:53778870-53778892 TCTAACTAGGCAAGGTCTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 69
954872564_954872568 17 Left 954872564 3:53778817-53778839 CCTGGGAGAAGCCACATAGGCTC 0: 1
1: 0
2: 1
3: 15
4: 193
Right 954872568 3:53778857-53778879 ATGTACATGATGGTCTAACTAGG 0: 1
1: 0
2: 0
3: 8
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954872564 Original CRISPR GAGCCTATGTGGCTTCTCCC AGG (reversed) Intronic
902624323 1:17667773-17667795 GGGCCTGTGGGGCTCCTCCCAGG + Intronic
903708444 1:25303981-25304003 GTGCATATGTGGCTGCTGCCGGG + Intronic
903718670 1:25388432-25388454 GTGCATATGTGGCTGCTGCCGGG - Intronic
904327837 1:29739034-29739056 GGGCCAAGGTGGTTTCTCCCAGG + Intergenic
904819581 1:33233024-33233046 GAGGTTATGTGGCTTGTCCAGGG + Intergenic
905185979 1:36197101-36197123 GAGCCCAGCTGGCTTCACCCAGG - Intergenic
905922022 1:41726190-41726212 GGGCCCATGTGGCTTCTCGAGGG - Intronic
906067748 1:42994309-42994331 CAGCCTCTTTGGCTTCCCCCAGG - Intergenic
906186157 1:43863703-43863725 GGGCCTCTGTGGGGTCTCCCAGG - Intronic
907185105 1:52603063-52603085 GGGCCTTTGTGCCCTCTCCCAGG - Intronic
907702099 1:56798786-56798808 GGGCCTATGTGACTTGTCCAAGG + Intronic
908394488 1:63713109-63713131 GAGCCCTTCTGGCTTCTCCTAGG + Intergenic
910981784 1:92965397-92965419 GAGCCCATCTGGCTTCTGCAGGG + Intergenic
912937016 1:114012439-114012461 AAGCCAATGTGGTTTTTCCCTGG - Intergenic
918605826 1:186424746-186424768 CAGTTTATGTGGCTTCTCCATGG + Intergenic
920678353 1:208054365-208054387 GAGCATGTGTGTCTCCTCCCTGG + Intronic
922184476 1:223261957-223261979 GAGGCTATGTGACTTGCCCCAGG + Intronic
923567095 1:235084356-235084378 GATCCTATGAGCCTTCCCCCTGG - Intergenic
924182028 1:241448497-241448519 GAGCCTCTGTTTCTTCTCACTGG + Intergenic
1063446395 10:6120647-6120669 GAGCCCATGGGCCTACTCCCAGG - Intergenic
1069049881 10:63781124-63781146 GAGCCTTAGTTTCTTCTCCCAGG + Intergenic
1069848639 10:71390697-71390719 CAGCCTATGCGCCCTCTCCCGGG - Intergenic
1070542721 10:77428207-77428229 GTCCCAATGTGGCTTCTCCAAGG + Intronic
1071523519 10:86345407-86345429 TAGGCTAGCTGGCTTCTCCCTGG - Intronic
1071592812 10:86892166-86892188 AAGCTAATGTGGTTTCTCCCTGG - Exonic
1072056799 10:91766305-91766327 AGGCCTACCTGGCTTCTCCCAGG - Intergenic
1074250996 10:111747249-111747271 GAGGCAATGAGGCATCTCCCAGG - Intergenic
1074975690 10:118579841-118579863 GAGGGTATGGGGCTTATCCCAGG - Intergenic
1075595200 10:123724109-123724131 GAGACTGTGTTGCTTCTGCCTGG - Intronic
1076618293 10:131771072-131771094 GAGGCTGTCTGGCTTCTCCCTGG + Intergenic
1076798382 10:132809665-132809687 GCTCCTCTGTGGCTCCTCCCCGG + Intronic
1078185132 11:9045877-9045899 GAGCCAATGTGTCTTGTCTCAGG - Intronic
1078326940 11:10388758-10388780 GTGCCTATGTGGTTTCCCCTCGG + Intronic
1078840834 11:15074433-15074455 GGGCGCGTGTGGCTTCTCCCTGG + Intronic
1083962633 11:66022803-66022825 GAGCATCGGTGGCTTCTCCATGG + Intronic
1084492060 11:69484272-69484294 GAGCCTCTGTGTCCTCTCACCGG - Intergenic
1086561823 11:88177134-88177156 GAGGTTATGTGACTTGTCCCGGG - Intergenic
1088481629 11:110300858-110300880 GAGCCCAGCTGGCTTCACCCAGG + Intergenic
1090461075 11:126892087-126892109 GAGGCTAAGTGGCCTCTCTCTGG - Intronic
1092658889 12:10717713-10717735 GAGCCAATCTGGCTTCTGCCTGG - Intronic
1092724854 12:11475121-11475143 TAGCCCCTGTGGCTGCTCCCAGG - Intronic
1093786313 12:23195609-23195631 GAACCTCTTTGGCTTCTCCAAGG - Intergenic
1096418340 12:51433067-51433089 TAGCCTCTGTGGCTGCTTCCAGG + Intronic
1096606694 12:52771804-52771826 GAGCTTATGCTGCTTCTCTCCGG + Intronic
1096664120 12:53150946-53150968 GAGGGTCTGTGGCTTCACCCAGG + Intergenic
1097101120 12:56590263-56590285 GAGCCTATGTGGATTCAACTAGG - Exonic
1098378517 12:69843587-69843609 ATGCCTATGGGGCTTCTCCAAGG - Intronic
1103225112 12:119280593-119280615 GAGCCTTTGTTTCTTCTCCTGGG + Intergenic
1104001765 12:124864427-124864449 GAGCCTGCGGGGCTTCTTCCAGG - Intronic
1106298614 13:28441228-28441250 GTGCGCATGTGGCTCCTCCCAGG + Intronic
1106552037 13:30780504-30780526 GAGCCCATGTGGGTGCTCCAGGG - Intergenic
1108573769 13:51773711-51773733 GTGGCTTTGTGGCTCCTCCCAGG + Intronic
1112005741 13:95252157-95252179 AGGCCTTTGTGGCTTCTCCTTGG - Intronic
1113160600 13:107376420-107376442 TTGCCTATGTTGCTTCCCCCTGG + Intronic
1113566974 13:111325096-111325118 CAGCCAGGGTGGCTTCTCCCAGG + Intronic
1113988611 13:114340264-114340286 TAGCCTCTGTGGCTTCCTCCAGG - Intergenic
1115770193 14:36659078-36659100 AAGGCTTTTTGGCTTCTCCCTGG + Intronic
1119615566 14:76096586-76096608 GACCCAATGTGGCTGCTCCGGGG - Intergenic
1120696361 14:87649759-87649781 AAGCCTTTGTGGCTTCTACGTGG + Intergenic
1122365591 14:101193203-101193225 GAGCCCATGTGGTTTCTGCTGGG - Intergenic
1122951373 14:105047026-105047048 TGGCCTATGCGGCCTCTCCCTGG + Intergenic
1124099169 15:26677492-26677514 GTGCATATGTGGTGTCTCCCGGG - Intronic
1126077860 15:44930909-44930931 CAGCCTATGGGGCTTATCCATGG + Intergenic
1126080678 15:44958062-44958084 CAGCCTATGGGGCTTATCCATGG - Intronic
1129829642 15:78660382-78660404 GAGGGTTTTTGGCTTCTCCCAGG - Intronic
1132311590 15:100861686-100861708 GAGGCATTGTGTCTTCTCCCAGG - Intergenic
1136047882 16:27629672-27629694 GAGACTAAGTGGCTTCCCCATGG - Intronic
1136271518 16:29151637-29151659 GAGCCTTTGTGCCTTCACCACGG - Intergenic
1136784608 16:32927093-32927115 GAGCCTAAGAGGCTTCCCCAAGG + Intergenic
1136885175 16:33926713-33926735 GAGCCTAAGAGGCTTCCCCAAGG - Intergenic
1137614813 16:49839757-49839779 GAGCCTCTGTCTCTTCACCCTGG - Intronic
1137626433 16:49911608-49911630 GAGCATGTGTGAATTCTCCCAGG + Intergenic
1140214631 16:72997437-72997459 GAGGCAATGGGGCTTCACCCTGG - Intronic
1142217572 16:88837421-88837443 GAGCCTATGAGACTCCTGCCTGG - Intronic
1203087267 16_KI270728v1_random:1191099-1191121 GAGCCTAAGAGGCTTCCCCAAGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143178025 17:4967751-4967773 GAGGCTGGGTGGCTTCTCCATGG + Exonic
1144625289 17:16841253-16841275 GAGTCTACATGGCTCCTCCCTGG - Intergenic
1144881140 17:18431468-18431490 GAGTCTACATGGCTCCTCCCTGG + Intergenic
1145151092 17:20512918-20512940 GAGTCTACATGGCTCCTCCCTGG - Intergenic
1145254269 17:21314212-21314234 GCCCCTATGAGTCTTCTCCCAGG - Exonic
1145322330 17:21773750-21773772 GCCCCTATGAGTCTTCTCCCAGG + Intergenic
1146162448 17:30567174-30567196 GAGTCTACATGGCTCCTCCCTGG - Intergenic
1146910786 17:36647102-36647124 TGGCTTATGTGGCTACTCCCTGG + Intergenic
1147160557 17:38567281-38567303 GAGGATATGTGGCTTGCCCCAGG + Intronic
1147579445 17:41619952-41619974 GAGTCTACATGGCTCCTCCCTGG - Intronic
1147721588 17:42543036-42543058 GAGGCTGTGTGGCTGCTCCAAGG + Exonic
1148564899 17:48626850-48626872 GGGCCTCTATGGCTTCTCCCCGG - Intronic
1153046294 18:858159-858181 GATCCTCTGTGGCTTCTCTGGGG - Intergenic
1155721421 18:29017621-29017643 GAAACTATGAGGCTTCTTCCAGG - Intergenic
1161311679 19:3598025-3598047 GAGCCTATGAGGGTGCGCCCTGG - Intronic
1163369870 19:16896135-16896157 GAGCCTATGTCTCTTATCTCTGG + Intronic
1164006614 19:21155650-21155672 GAGCCTATGGGGTTTGTCACTGG + Intronic
1166859401 19:45801146-45801168 GAGCCTCAGTGGCTGCACCCAGG + Intronic
1167278003 19:48550455-48550477 GAGGTAATGTGGCTTCCCCCAGG - Intergenic
1167465110 19:49646504-49646526 GAGCCTCTCTGGCCTCTTCCAGG + Exonic
1167537009 19:50060129-50060151 GCACCTGTGGGGCTTCTCCCTGG + Intergenic
1168688559 19:58363028-58363050 GGGCCAACGTAGCTTCTCCCTGG + Intergenic
924959179 2:18522-18544 TAGCCTTTGTGGCTTCCTCCAGG + Intergenic
928489095 2:31762488-31762510 CAGCCTCAGTGGCTTCTGCCCGG - Intergenic
929912459 2:46101754-46101776 GAGACGATGTGGCTTGTCCGAGG + Intronic
934558571 2:95300450-95300472 CAGCCAATGTGGCTTCTGCACGG + Intronic
936155189 2:110042547-110042569 GAGCCCAGGAGGCTTCTTCCAGG - Intergenic
936189493 2:110328867-110328889 GAGCCCAGGAGGCTTCTTCCAGG + Intergenic
937608121 2:123826669-123826691 GAGCCCAGCTGGCTTCTCCTAGG + Intergenic
942084043 2:172427911-172427933 GAGCCTCTTCGGCTTCTCGCTGG + Exonic
943358558 2:186890537-186890559 GTGCCTACATGGCTTCTCCTCGG + Intergenic
944656372 2:201880309-201880331 GGTCCTATCTTGCTTCTCCCAGG - Intronic
945023124 2:205594089-205594111 GAGCCTGTGTGGTTTCTGGCAGG + Intronic
1169329541 20:4705718-4705740 GGCCCTATGTGGCTTCTCCAAGG + Intergenic
1169343415 20:4812777-4812799 GAGGTTAGGTGGCTTGTCCCAGG + Intronic
1171067902 20:22036729-22036751 GTGCCTGTGTGGGTTCTTCCAGG - Intergenic
1173031188 20:39361970-39361992 CAGACTATCTGGCTTCTACCAGG + Intergenic
1173390362 20:42626692-42626714 GACCCTCTGTGGCTACTCCCAGG - Intronic
1173553592 20:43950008-43950030 GAGGCTAGGTGGCTTGTCCAAGG - Intronic
1175143633 20:56879655-56879677 GAGGCTAGGTGGCTTGTCCAGGG + Intergenic
1180712931 22:17852081-17852103 GAGGCTGTGTGGCTGCTCACAGG - Intronic
1181313976 22:21960265-21960287 GAGGCTCCCTGGCTTCTCCCTGG - Intronic
1182023479 22:27100092-27100114 GGGCTGATGTGGCTTGTCCCAGG - Intergenic
1184210270 22:43031209-43031231 GTGCCTCTGTGCTTTCTCCCCGG - Intergenic
1184502048 22:44880253-44880275 CTGCCAATGTGGCTGCTCCCTGG - Intergenic
1184951739 22:47847949-47847971 GGGCCCACGTGGCTTCTTCCAGG - Intergenic
1185182316 22:49370421-49370443 GAAGCTCTGTGGCTTCCCCCAGG + Intergenic
949823564 3:8140841-8140863 GAGATTATGTGGTTTGTCCCAGG + Intergenic
954872564 3:53778817-53778839 GAGCCTATGTGGCTTCTCCCAGG - Intronic
955444655 3:58996895-58996917 GAACCTCTGTGGCTCCACCCCGG - Intronic
956776755 3:72571595-72571617 GAGGCTCTATGGCTTCTCCAAGG + Intergenic
959801825 3:110504357-110504379 GGGCATATGTGCCTGCTCCCAGG + Intergenic
962092022 3:132254392-132254414 GAGGCTAAGTGACTTGTCCCAGG - Intronic
963854244 3:150237813-150237835 AAGGCTATGTTGCCTCTCCCAGG + Intergenic
963921370 3:150909103-150909125 GACCCTAAGTGACTTCTCCAAGG - Intronic
964021612 3:152020229-152020251 CAGCCTATGTGCCCTCTCTCTGG - Intergenic
967129511 3:186457670-186457692 CAGACTATGTCTCTTCTCCCGGG - Intergenic
968513288 4:1004575-1004597 GAGGCTCTGTGGCTTGGCCCTGG + Intergenic
968672545 4:1859492-1859514 GAGACTATGAGGCTTGTCCCAGG + Intergenic
968932411 4:3588196-3588218 CAGCCTAGGTCTCTTCTCCCTGG - Intronic
969036174 4:4255731-4255753 GAGCTTACGTGACTTGTCCCAGG - Intergenic
970217830 4:13778278-13778300 GAGCCTATGTTCTTTGTCCCAGG + Intergenic
973015699 4:45134688-45134710 GAGTGTCTGTGGCTTTTCCCAGG + Intergenic
978798474 4:112731839-112731861 GTGCCTATGTGGCTGTTCACAGG + Intergenic
980084471 4:128377299-128377321 AAGCCTTGGTGGCTTCTCCATGG - Intergenic
980386116 4:132089440-132089462 GAGTCTCTGTGGCTTTTCCAGGG - Intergenic
982288772 4:153759867-153759889 GAGCCACTGTGCCTTCTCCAGGG + Exonic
982647746 4:158044567-158044589 GAGCCCAGCTGGCTTCACCCAGG - Intergenic
986200323 5:5573300-5573322 GGGCCTCTGTGGATTCTCCAAGG - Intergenic
986332849 5:6730264-6730286 GATCCTATGTGGCTCATCCCAGG + Intronic
987460027 5:18198087-18198109 AAGCCTTTGTGGCTTCTACGTGG + Intergenic
989279339 5:39622556-39622578 GCGCCATTGTGGCTGCTCCCAGG + Intergenic
989691407 5:44149301-44149323 AAGCTTATTTTGCTTCTCCCCGG - Intergenic
991473882 5:66999242-66999264 TAAGCTATGGGGCTTCTCCCAGG + Intronic
993532835 5:89045004-89045026 GAGGGTATGTGGTTGCTCCCTGG + Intergenic
994029409 5:95124102-95124124 GGGCCTTTGTGGCATCTCTCAGG - Intronic
998052397 5:139046797-139046819 GAACCAATGTGGCTGATCCCAGG - Intronic
998118958 5:139560981-139561003 GGGCCTAAGTGCCTCCTCCCGGG + Intronic
999094766 5:148968144-148968166 GAGCCTCTCTGCTTTCTCCCGGG - Intronic
999379471 5:151110119-151110141 GAGTCTATGTGGGTCCTCCTAGG - Intronic
999616604 5:153431778-153431800 GAGCTTAAGTGGCTTCTCCAAGG + Intergenic
999674621 5:153986813-153986835 GAGCATTTTTGGCTTTTCCCAGG + Intergenic
1000296931 5:159920296-159920318 GAGATGATGTGGCTTCTCTCTGG + Intronic
1000961826 5:167609718-167609740 GAGCCAAAGTGGCTTCTCATGGG - Intronic
1001885684 5:175288192-175288214 CTGCCTCTGTGGCTCCTCCCTGG - Intergenic
1002755639 6:157031-157053 TAGCCTTTGTGGCTTCCTCCAGG + Intergenic
1003081988 6:3028118-3028140 GAGCCCAGCTGGCTTCACCCAGG - Intergenic
1003137740 6:3446167-3446189 CACCCTTTGTGACTTCTCCCTGG - Intronic
1007371815 6:41431040-41431062 GAGCCATTGTGGCTTCACCCTGG - Intergenic
1007726737 6:43921342-43921364 CCGCCTCTGTGCCTTCTCCCTGG - Intergenic
1013057683 6:106600221-106600243 GAGCCTCTGAGGCTACTCGCTGG + Intronic
1014358630 6:120445722-120445744 GAGTCCATCTGGCTTTTCCCAGG + Intergenic
1015076042 6:129158829-129158851 AAGCTAATGTGGTTTCTCCCTGG + Intronic
1015530167 6:134213732-134213754 GAGCCCATGTGGATTCAGCCAGG - Intronic
1018437524 6:163776259-163776281 GAGCCTGTGTGCCTTCCCGCTGG + Intergenic
1022137590 7:27463926-27463948 TTGCCTAAGTGGCTTCTCCCAGG - Intergenic
1022443476 7:30451976-30451998 GAGCCTCTTTGTCTTCACCCAGG - Exonic
1022649231 7:32259521-32259543 GAGCCTCTGTGGCTTCATCTGGG + Intronic
1023140178 7:37094309-37094331 GAGCATCTGTGGCATCTCCAGGG + Intronic
1023392988 7:39728487-39728509 TAGCCAATGTGTCTTCACCCCGG + Intergenic
1023610556 7:41966587-41966609 GGGCCCATGACGCTTCTCCCGGG - Exonic
1025015844 7:55438647-55438669 AAGCCTCTGTGCCTTCTCCAAGG - Intronic
1026929955 7:74218249-74218271 GTTCCTCTGTTGCTTCTCCCAGG + Intronic
1028094710 7:86745531-86745553 GAGACTATGTGGCTTCTCCAAGG - Intronic
1029032061 7:97478937-97478959 GATCCTCTGTAGCTTCTCTCCGG - Intergenic
1029467269 7:100734143-100734165 GACCCTAAGTGGTTGCTCCCAGG - Exonic
1031036430 7:116792974-116792996 AAGCCTATGAGGCTTTTCTCTGG - Intronic
1031865592 7:127035787-127035809 GAGCCTGTGTGGCTCCTCTACGG - Intronic
1032061066 7:128725833-128725855 GACCCTTTTTGCCTTCTCCCTGG - Intronic
1036690717 8:10943112-10943134 GAGCCTTAGTGGCTGCTTCCTGG + Intronic
1037559016 8:20055166-20055188 GAGCCCAGCTGGCTTCACCCAGG - Intergenic
1038630265 8:29235571-29235593 GGGCCACTGTGGCTTCTTCCTGG - Intronic
1038701979 8:29857356-29857378 GAGCCTTTGTAGCTGCTCACAGG - Intergenic
1040375720 8:46822859-46822881 GAGGCAATGTGGCATATCCCTGG + Intergenic
1045294173 8:100859661-100859683 GAGCTTACATGGCTTGTCCCGGG + Intergenic
1045870846 8:106925195-106925217 AAGCCTCTGGGGCTTCTCCCAGG - Intergenic
1048291661 8:133185946-133185968 GAGGTTATGTGACTTCTCCCAGG + Intergenic
1049099382 8:140568330-140568352 GCGCCTCTGTGCCTTTTCCCTGG - Intronic
1050372444 9:4935364-4935386 TAGCCTATATGGCTTCTGCCTGG - Intergenic
1050892082 9:10836396-10836418 GAGCATAGCTGGCTTCACCCAGG - Intergenic
1054457717 9:65443700-65443722 CAGCCTAGGTCTCTTCTCCCTGG + Intergenic
1056831739 9:89922979-89923001 GAGCCTGGAAGGCTTCTCCCAGG + Intergenic
1056901143 9:90600478-90600500 GAGCCTTTGCTGATTCTCCCTGG + Intergenic
1057456326 9:95215633-95215655 AAGGCTATGTAGCTTCTGCCTGG + Intronic
1061327720 9:129874306-129874328 GAGGCTTTGTGGCTTCTCAAAGG + Intronic
1062007104 9:134244935-134244957 ATGCCTAGGTGGCTTCTCCCTGG - Intergenic
1062320443 9:135988192-135988214 GAGCCTCAGGGGCTGCTCCCCGG + Intergenic
1187948430 X:24448750-24448772 TAGCCTTTCTGGCTTCTCCTAGG - Intergenic
1192237145 X:69303208-69303230 GAGGCTAAGTGGCTTCCCCAAGG + Intergenic
1192595819 X:72407288-72407310 GAGCTTCTGTGGCTTCACCCCGG - Intronic
1194493358 X:94578350-94578372 GAGCCTGGCTGGCTTCTCACCGG + Intergenic
1196228771 X:113196564-113196586 GGACCTATCTGGCTGCTCCCTGG - Intergenic
1199050155 X:143228612-143228634 GAGCCCAGCTGGCTTCACCCAGG + Intergenic
1199385449 X:147217617-147217639 GAGCCTTGGTGGCTTCCACCTGG + Intergenic