ID: 954874053

View in Genome Browser
Species Human (GRCh38)
Location 3:53789580-53789602
Sequence CAGGCCACGCCCACTCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954874053_954874064 25 Left 954874053 3:53789580-53789602 CCCCTGAGAGTGGGCGTGGCCTG 0: 1
1: 0
2: 0
3: 21
4: 155
Right 954874064 3:53789628-53789650 TCCCACAGCAGGGTGCCCCATGG 0: 1
1: 0
2: 2
3: 26
4: 245
954874053_954874058 -7 Left 954874053 3:53789580-53789602 CCCCTGAGAGTGGGCGTGGCCTG 0: 1
1: 0
2: 0
3: 21
4: 155
Right 954874058 3:53789596-53789618 TGGCCTGTTGAGATGGAGGATGG 0: 1
1: 0
2: 0
3: 28
4: 349
954874053_954874060 14 Left 954874053 3:53789580-53789602 CCCCTGAGAGTGGGCGTGGCCTG 0: 1
1: 0
2: 0
3: 21
4: 155
Right 954874060 3:53789617-53789639 GGCTTGCCTCCTCCCACAGCAGG 0: 1
1: 0
2: 4
3: 20
4: 257
954874053_954874067 29 Left 954874053 3:53789580-53789602 CCCCTGAGAGTGGGCGTGGCCTG 0: 1
1: 0
2: 0
3: 21
4: 155
Right 954874067 3:53789632-53789654 ACAGCAGGGTGCCCCATGGCTGG 0: 1
1: 0
2: 3
3: 22
4: 191
954874053_954874061 15 Left 954874053 3:53789580-53789602 CCCCTGAGAGTGGGCGTGGCCTG 0: 1
1: 0
2: 0
3: 21
4: 155
Right 954874061 3:53789618-53789640 GCTTGCCTCCTCCCACAGCAGGG 0: 1
1: 0
2: 2
3: 21
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954874053 Original CRISPR CAGGCCACGCCCACTCTCAG GGG (reversed) Intronic
900431140 1:2603794-2603816 CAGGCAACGTGCCCTCTCAGAGG + Intronic
901148365 1:7083634-7083656 CAGGCCCTGCCCTCTCCCAGTGG - Intronic
904542716 1:31244122-31244144 CAGGCCATCCCCACTCCCACAGG - Intergenic
904674123 1:32187823-32187845 CAGGCCAGGAGCACTCTCATGGG - Intronic
905404399 1:37723293-37723315 CAGGCCCAGCCAACTCACAGTGG + Exonic
907241101 1:53081552-53081574 CAGGCCAGGGCCACACTCAGGGG - Intronic
910436430 1:87210531-87210553 CAGGCCTCTCCCAGCCTCAGGGG + Intergenic
912500506 1:110119027-110119049 CAGGCCCTGCCCACATTCAGAGG + Intergenic
912559628 1:110540757-110540779 CAGACCACCCCCAAACTCAGTGG - Intergenic
913011847 1:114691260-114691282 CATGCCAGGCCCACTCCCCGAGG - Intronic
917001657 1:170367573-170367595 GAGGGCAAGGCCACTCTCAGTGG + Intergenic
917928615 1:179808696-179808718 CAGGCCACACCCATACTCAGGGG + Intronic
920364175 1:205439445-205439467 CAGCTCATGCCCACACTCAGGGG - Intronic
921060050 1:211578160-211578182 CCGGCCACGGCCACTCGCACGGG - Exonic
922788871 1:228298696-228298718 TCGGCCACGCTCACTGTCAGGGG + Exonic
922789087 1:228300124-228300146 TCGGCCACGCTCACTGTCAGGGG + Exonic
923474878 1:234322934-234322956 CAGGCCCTGCCCACTCTCCAGGG + Intronic
1064693607 10:17943217-17943239 CAGGCCCCGCCCACACTTAAGGG - Intergenic
1067060063 10:43073687-43073709 CTGCCCACGCCCACTCTGAGAGG + Intergenic
1067084572 10:43230985-43231007 CAGGCCAGGCCAACACTCACTGG - Intronic
1069373560 10:67771380-67771402 CAGGCCACGTCCTCTGTCACTGG - Intergenic
1069646349 10:70001308-70001330 TAGGCCACACCCACTCATAGTGG - Intergenic
1071652556 10:87407660-87407682 GAGGCTACGCACAATCTCAGGGG + Intergenic
1074535770 10:114327910-114327932 CAGGCCAGGCCCAGCCTCCGAGG + Intronic
1078067394 11:8087369-8087391 CAAGCCACTCACACTTTCAGAGG - Intronic
1081406391 11:42703530-42703552 CATGCCACCACCACTCTCTGAGG + Intergenic
1083329042 11:61888656-61888678 CAGGGCACGCTCACACTTAGGGG + Intronic
1089616254 11:119696506-119696528 CAGGCTCTGCCCGCTCTCAGTGG - Intronic
1090243033 11:125197414-125197436 CAGGCCACCCCTACCCTGAGTGG + Intronic
1090918837 11:131190726-131190748 CAGCCCACTCCCACCCTCAGTGG - Intergenic
1095729520 12:45491526-45491548 CAGGCCACCCTCTCTATCAGTGG + Intergenic
1095934180 12:47658773-47658795 CAGGCCACTTCCACCCTGAGAGG + Intergenic
1096509832 12:52121594-52121616 CAGGCCATGCCCAGCCTCAGAGG - Intergenic
1096673734 12:53215180-53215202 CAGGGCAGGCCAAGTCTCAGAGG + Intronic
1103694070 12:122799878-122799900 CAGGCCACAACCCCTCGCAGAGG - Intronic
1104437130 12:128765400-128765422 CAGGCCACTCAGACTCCCAGAGG + Intergenic
1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG + Exonic
1105389105 13:19958877-19958899 CCAGCCACCCCCACTCTCGGCGG - Intronic
1110791826 13:79594045-79594067 CAGGCCATGCCCATGCTCAGTGG + Intergenic
1112580955 13:100675518-100675540 CACCACACTCCCACTCTCAGAGG + Intergenic
1113629935 13:111875295-111875317 CAGGCAACGCAAACTCACAGAGG - Intergenic
1114639975 14:24213177-24213199 CCGTCCTCCCCCACTCTCAGAGG - Intronic
1116088187 14:40268193-40268215 CAGGCCTCACCCACACTCAAGGG + Intergenic
1119705215 14:76779036-76779058 CAGGCCCCACCCACTCTTGGGGG + Exonic
1120912599 14:89681179-89681201 CCAGCCACGCTCCCTCTCAGGGG - Intergenic
1122209610 14:100166091-100166113 CAGGCTACCCCCACTCTCCCGGG - Intergenic
1122543794 14:102511332-102511354 CAGGCCACGCCATCTCTCCCAGG + Intergenic
1124700314 15:31906895-31906917 CAGACCAAGCCCACTCACAGGGG - Intergenic
1124845335 15:33284469-33284491 CAAACCACTCCCACACTCAGTGG + Intergenic
1126799144 15:52284430-52284452 CTGGCCCCACCCACCCTCAGAGG - Intronic
1129058551 15:72840295-72840317 AAGGTCCCGCCCACTCTCAAGGG + Intergenic
1130876156 15:88016569-88016591 CAGGGCACACCCCCTCCCAGGGG + Intronic
1132639442 16:971003-971025 GAGGCCCCGCCCATTCTCGGAGG + Intronic
1132639449 16:971022-971044 GAGGCCCCGCCCATTCTCGGAGG + Intronic
1132949719 16:2554385-2554407 CAGACCACTGCCACTCTCACGGG - Intronic
1132964629 16:2645782-2645804 CAGACCACTGCCACTCTCACGGG + Intergenic
1133324602 16:4935540-4935562 CAGGCCCTGCCCAGTCTCTGGGG + Intronic
1139378674 16:66516615-66516637 CAGGCCACACTGACTCTCATGGG - Intronic
1142215349 16:88827046-88827068 CAGGCCACGCCCTCACTCCCTGG + Intronic
1142247794 16:88977696-88977718 CAGGGCTCCCCCACTCTCCGGGG + Intergenic
1143025240 17:3937705-3937727 CAGCCCACCCCCAATCTTAGGGG + Intronic
1143280699 17:5752146-5752168 CAGGCAGAGCCCACTCTCTGAGG - Intergenic
1144703278 17:17352036-17352058 CAGGGCACGCTCACCCCCAGGGG + Intergenic
1145023936 17:19453492-19453514 CAGACCACGCTCAGTCTCTGGGG - Intergenic
1148338282 17:46856334-46856356 CAGTCCAGGCTCACTCTCAGTGG + Intronic
1149530936 17:57394729-57394751 CAAGTCACGCCCACTGGCAGAGG - Intronic
1149990864 17:61382924-61382946 CAGGGCACCCCCTCTCACAGAGG + Intronic
1152241145 17:79161887-79161909 CTGGCCACACCCACACTCTGTGG + Intronic
1157564401 18:48670165-48670187 GAGGGCACGCCCACTCACAGAGG + Intronic
1160298217 18:77656620-77656642 CAGGCCTTGCCATCTCTCAGAGG - Intergenic
1160575494 18:79850905-79850927 CAGGCCCCGTCCACTCTGTGCGG - Intergenic
1161293045 19:3506141-3506163 CAGGCCCTGCCCACTCCGAGTGG - Intergenic
1162780101 19:13002411-13002433 GAGGCCACTCCCGCCCTCAGAGG - Intronic
1163587774 19:18173339-18173361 CAGGCCTTGCCCACTCTCGGGGG + Intronic
1163741167 19:19013785-19013807 CAGGGCTGGCCCACTCCCAGGGG + Intronic
1165073314 19:33267920-33267942 CAGGCAATGCCCACCCTGAGTGG + Intergenic
1165107870 19:33484966-33484988 CAGGGCACGCCTACCCTCACAGG - Intronic
1165339775 19:35203130-35203152 CAGGCCATGGCCACTCTTATAGG - Intergenic
1166568426 19:43779143-43779165 CAGGCCACTGCCTCTATCAGTGG - Intronic
1168256201 19:55166677-55166699 CGGGCCTCGCTCACTCTCATTGG - Intronic
1168276161 19:55279856-55279878 CAGGCCCCACCCACTCTCCCTGG + Intronic
925993076 2:9269426-9269448 CGGGCCAAGCCCACTATCTGAGG - Intronic
926088687 2:10036230-10036252 CAGGCCAGGCCCTCTGCCAGGGG - Intergenic
927150806 2:20194754-20194776 CAGGCCACGGCCCCTCTCACAGG + Intergenic
933994714 2:87659774-87659796 CAGTCCACGACCACTGGCAGGGG + Intergenic
934689551 2:96347825-96347847 CTTGCCATGCCCACTCTGAGTGG + Intronic
935110666 2:100091735-100091757 CAGGCCAGGCCCAGAATCAGAGG - Intronic
935839879 2:107097802-107097824 CAGGTCCAGCCCACTCTCAAGGG + Intergenic
936043939 2:109171778-109171800 CCGGCCACGCTCACTTGCAGCGG + Intronic
936050993 2:109223458-109223480 CAGGCCATGCCCACTCCCAAAGG - Intronic
936124305 2:109773427-109773449 CAGGCCAGGCCCAGAATCAGAGG + Intergenic
936175178 2:110213454-110213476 CAGGTCACACCCACACTCAAGGG - Intergenic
936220384 2:110598037-110598059 CAGGCCAGGCCCAGAATCAGAGG - Intergenic
936299142 2:111291139-111291161 CAGTCCACGACCACTGGCAGGGG - Intergenic
940970801 2:159894534-159894556 AAGTCCACACCCACCCTCAGTGG - Intronic
941676508 2:168348274-168348296 CAGGCAACTCCCACCCTGAGTGG + Intergenic
942349733 2:175039696-175039718 AAGGCCCAGCCAACTCTCAGTGG + Intergenic
944089505 2:195890187-195890209 CACCCCACACCCACACTCAGAGG + Intronic
945950885 2:216037600-216037622 AAGGACACACTCACTCTCAGGGG + Intronic
948496146 2:238351149-238351171 CACTCGACGCCCACTCCCAGGGG - Intronic
948562805 2:238865376-238865398 CAGGCCCCCCTCACTCTCCGGGG - Intronic
948567135 2:238894393-238894415 CTTGCCACCCCCACACTCAGCGG + Intronic
948978783 2:241481854-241481876 CAGGCTGCGCCCCCTCTCTGAGG + Intronic
1169209623 20:3758882-3758904 CCCCCCACGCTCACTCTCAGGGG - Intronic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1173690943 20:44960443-44960465 CAGGCCCCGCCCCCTCGCCGCGG - Exonic
1175288412 20:57854599-57854621 CAGGTCTCACCCACACTCAGGGG + Intergenic
1175306291 20:57977853-57977875 CAGGCCACTGACACCCTCAGTGG - Intergenic
1176085668 20:63294423-63294445 CAGGCCCGGCCCACTCAAAGGGG - Intronic
1176223255 20:63979801-63979823 CAGCCCACCCCCACGCACAGAGG - Intronic
1178498161 21:33104284-33104306 CAGGCCACAGCCTCTCTCAAAGG + Intergenic
1179175814 21:39007155-39007177 CAGCCCACGGCCCCTCACAGAGG + Intergenic
1179183157 21:39062211-39062233 CAGGCCACGGCCCCCCTCTGCGG + Intergenic
1179279625 21:39923594-39923616 TTGGCCACGCCCACTCTCCATGG - Intronic
1180014303 21:45072771-45072793 CAGGCCACCCCAAACCTCAGAGG - Intergenic
1181106294 22:20577719-20577741 CAGGCCCCGCCCATTCGCACTGG + Intronic
1184368502 22:44067990-44068012 CATGCCTGGCCCACTCCCAGGGG - Intronic
1184874689 22:47266750-47266772 CTGGCCAAGCCCAGTGTCAGTGG + Intergenic
949903357 3:8838162-8838184 CAGACCACTCCCAAACTCAGTGG - Intronic
950480451 3:13240452-13240474 CAGACCAAGCCAACACTCAGAGG + Intergenic
950525205 3:13519137-13519159 CCGGCCTCGCCCACCCCCAGAGG - Intergenic
951082602 3:18469381-18469403 CAGTCCACCAACACTCTCAGTGG + Intergenic
953280239 3:41547919-41547941 CAGGCCACTCTCAGTCTCTGAGG - Intronic
954874053 3:53789580-53789602 CAGGCCACGCCCACTCTCAGGGG - Intronic
954877477 3:53811639-53811661 CAGGCCCCGCCCTCTCACAGAGG + Exonic
955376215 3:58399477-58399499 CAGGCCACGCCAACTCTGCAGGG - Intronic
957080974 3:75635103-75635125 CAGGCCACTCCCACACACACCGG - Intergenic
958576912 3:95962140-95962162 AAAGCCATGACCACTCTCAGTGG + Intergenic
961441037 3:126953321-126953343 CAGACCTCGCCCAGCCTCAGTGG - Intronic
968090563 3:195895960-195895982 CAGGCCACGCCCCCGCCCCGAGG + Intronic
968504857 4:967040-967062 TAGGCCACGCCCACCCTGTGGGG + Exonic
968540878 4:1167752-1167774 GAGGCCACGCCCACCCTTCGGGG + Intronic
968938607 4:3626343-3626365 CAGGGCCCGCCCACTGGCAGTGG - Intergenic
974845309 4:67344739-67344761 CAGACCATACCAACTCTCAGGGG - Intergenic
975266815 4:72379162-72379184 CAGGCTCTGCCCACACTCAGGGG + Intronic
984070844 4:175110082-175110104 CAGGCCACCACCACTATCACTGG + Intergenic
985099419 4:186443250-186443272 TAGCCCACACCCACTCTCAGTGG + Intronic
995110007 5:108418348-108418370 CATGCCTGGCTCACTCTCAGTGG + Intergenic
996927510 5:128845923-128845945 CAGGTGACGCCCACCCACAGAGG + Intronic
1004143087 6:13039030-13039052 TAGGCCACACCTACCCTCAGAGG + Intronic
1006813114 6:36833386-36833408 CAGGTCCCGCCCACTCTCAAGGG - Intronic
1007029586 6:38615972-38615994 CAGGTCCTGCCCACTCTCAAGGG - Intronic
1008030316 6:46687830-46687852 CTGGCCCCGCCCACTCTCCGCGG + Intergenic
1008638489 6:53436593-53436615 AAGACCACGCCCCTTCTCAGTGG + Intergenic
1009967803 6:70595189-70595211 CTGGCCTCACTCACTCTCAGAGG + Intergenic
1013233512 6:108176724-108176746 CAGCCCACGCCCAAGGTCAGCGG + Exonic
1013576167 6:111484497-111484519 AAGGTCACGCCCAATATCAGTGG - Intergenic
1014102482 6:117527256-117527278 CAGCCCCCACCCACACTCAGGGG + Intronic
1014342847 6:120230031-120230053 CAGGCCACACCCACTGCCAGGGG + Intergenic
1015776164 6:136816570-136816592 TAGGTCAAGCCCACTCTCATGGG - Intergenic
1019280428 7:197063-197085 ATGGCCATGCTCACTCTCAGGGG - Intronic
1019713705 7:2529027-2529049 CAGGCCCCGACCCCGCTCAGGGG + Intronic
1022038712 7:26558770-26558792 GAGGCCACGGACACACTCAGGGG + Intergenic
1023083251 7:36545267-36545289 CAGGCCACACCCACTTTTAAGGG - Intronic
1024996380 7:55275822-55275844 CAGGCCAGGCGCACTCACTGTGG - Intergenic
1026549534 7:71356475-71356497 GAGGCTGTGCCCACTCTCAGAGG + Intronic
1034076788 7:148239762-148239784 CAGGCCACCTCCACACTGAGAGG + Intronic
1035577364 8:716349-716371 CAGGCCATGACCCCTGTCAGTGG + Intronic
1035766949 8:2113919-2113941 AAGGCCATGCCTGCTCTCAGGGG + Intronic
1037786134 8:21904326-21904348 CTGGCCACCCCCACTGTCACAGG + Intergenic
1041362244 8:57066228-57066250 CTGGCCACTCTCTCTCTCAGGGG - Intergenic
1050756600 9:9011898-9011920 CAGGTCCTGCCCACACTCAGTGG - Intronic
1057193150 9:93098364-93098386 CTGGCCCCACCCACTCTCACCGG - Intronic
1060549583 9:124478589-124478611 CAGGCCAGGACGACTCCCAGAGG - Exonic
1061094996 9:128451384-128451406 CAGGCCACCCCGAAGCTCAGAGG - Intergenic
1061273976 9:129558887-129558909 CAGGTCACGCCCACCCTCCGGGG + Intergenic
1061743553 9:132724068-132724090 CAGCCCAGGCCCTCTCTGAGGGG - Intergenic
1062165863 9:135106934-135106956 CAAGCCACGCCCACCCTCCAGGG + Intronic
1062410541 9:136422009-136422031 CAGGCCTCGGCCAGGCTCAGAGG + Intronic
1062624082 9:137435171-137435193 CACGCCCCGCCCACGCCCAGGGG + Intronic
1185820672 X:3200748-3200770 CAGGGCAAGCCCACACTCAGTGG - Intergenic
1186305014 X:8247027-8247049 CAGGCCAAACCCACACTCAAGGG + Intergenic
1187253733 X:17622690-17622712 CAGGCCATCACCACACTCAGTGG - Intronic
1188153519 X:26710778-26710800 AAGCCCACCCCCACTCCCAGAGG - Intergenic
1190248231 X:48704839-48704861 CAGGCCCGGTCCACTCTCAGGGG - Intronic
1195962865 X:110403374-110403396 CAGGTCAAGTCCACTTTCAGTGG - Intronic
1200152467 X:153957984-153958006 CAGGCTACGGCCACTGCCAGTGG - Intronic