ID: 954874118

View in Genome Browser
Species Human (GRCh38)
Location 3:53789930-53789952
Sequence TCCTTCCCACACATGGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954874118_954874122 0 Left 954874118 3:53789930-53789952 CCTGGATCCATGTGTGGGAAGGA 0: 1
1: 0
2: 1
3: 26
4: 203
Right 954874122 3:53789953-53789975 GCTCGGCATCCGGTGTCTTCTGG 0: 1
1: 0
2: 0
3: 2
4: 50
954874118_954874124 9 Left 954874118 3:53789930-53789952 CCTGGATCCATGTGTGGGAAGGA 0: 1
1: 0
2: 1
3: 26
4: 203
Right 954874124 3:53789962-53789984 CCGGTGTCTTCTGGCCTCTGTGG 0: 1
1: 0
2: 1
3: 35
4: 238
954874118_954874121 -10 Left 954874118 3:53789930-53789952 CCTGGATCCATGTGTGGGAAGGA 0: 1
1: 0
2: 1
3: 26
4: 203
Right 954874121 3:53789943-53789965 GTGGGAAGGAGCTCGGCATCCGG 0: 1
1: 0
2: 2
3: 15
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954874118 Original CRISPR TCCTTCCCACACATGGATCC AGG (reversed) Intronic
900095278 1:937673-937695 ACCTGGCCACACACGGATCCAGG - Intronic
900245730 1:1635178-1635200 CCCCTCCCACACATGGTCCCGGG + Intronic
900256960 1:1702335-1702357 CCCCTCCCACACATGGTCCCGGG + Intronic
901462161 1:9398298-9398320 TCCTGCCCCCACTGGGATCCTGG - Intergenic
903189832 1:21650415-21650437 TGCTACCCACACATGCGTCCTGG - Intronic
904901277 1:33859220-33859242 TCCTCCCCACACCTTGATCTTGG - Intronic
905400909 1:37702533-37702555 TCCTCCACAGACATGCATCCCGG - Intronic
905597365 1:39219668-39219690 TCCTTGCCACATCTTGATCCTGG - Intronic
906814961 1:48869319-48869341 TCCTTCCCTAACACGGAACCAGG + Intronic
907044932 1:51294819-51294841 TCCTCCCCAGAAATGGAGCCTGG - Intronic
907514926 1:54987793-54987815 CCCCTCACACACAGGGATCCAGG - Intronic
908179703 1:61591721-61591743 TTCTTCTCACACTTGGCTCCCGG - Intergenic
908762430 1:67524551-67524573 TCCTACCCAGGCAGGGATCCTGG + Intergenic
916178413 1:162062541-162062563 TCCGTCTCACACATGGACACAGG + Intergenic
923199132 1:231694635-231694657 TCTTTACCAGACATGGACCCTGG + Exonic
923330637 1:232920806-232920828 TCCTGCCAACACATTGATCTTGG + Intergenic
1063750021 10:8933767-8933789 TCCTTCCCTCACAAGGAAACAGG - Intergenic
1067346360 10:45441635-45441657 TCCTTCTCACTGATGGCTCCTGG + Intronic
1067942912 10:50670935-50670957 TTCCTCCCACAGATGGATGCAGG - Intergenic
1069597588 10:69682388-69682410 TCCTTCCCACTCTTGGATAAAGG - Intergenic
1070403140 10:76070939-76070961 TCCTTGCCACTGATGGAGCCAGG + Intronic
1071631051 10:87218127-87218149 TTCCTCCCACAGATGGATGCAGG - Intergenic
1071716665 10:88103879-88103901 TTCTTCCCTCACATGAACCCTGG - Intergenic
1073038283 10:100579627-100579649 TCCTTCCCACACACTCACCCTGG - Intergenic
1076303730 10:129448139-129448161 CACTTAGCACACATGGATCCTGG + Intergenic
1077337994 11:2013976-2013998 TCCTGCCCACACAGGGAGTCAGG + Intergenic
1077705543 11:4481770-4481792 CCCTTCCCACACAGGTACCCTGG - Intergenic
1077840072 11:5964693-5964715 TCCATCTCACACATGGCTACGGG + Intergenic
1080276977 11:30513720-30513742 TCTGTCCTATACATGGATCCTGG + Intronic
1081176239 11:39930814-39930836 TCCTTCCCTCTCATGCCTCCTGG - Intergenic
1081517052 11:43843385-43843407 TCCAGCCCACACATGTTTCCTGG + Intronic
1081744734 11:45464877-45464899 TCCTTTCCAAGCATGGATACTGG - Intergenic
1081771217 11:45651533-45651555 CCCTTCCAACTCATGGATGCAGG + Intronic
1083700582 11:64475201-64475223 TCTTTCCCACACATGTGTCAGGG - Intergenic
1084096435 11:66914543-66914565 TCCTTCCCTCAAAGGGATCCTGG - Intronic
1086413834 11:86569311-86569333 TTCTTCCCACACATGCATTCTGG + Intronic
1087346905 11:96983040-96983062 TGCTTACCACCCATTGATCCTGG - Intergenic
1087696457 11:101382551-101382573 ACCTTCCAACACATGAATTCTGG - Intergenic
1087933419 11:104003887-104003909 TCCTTCCCAGCCATTGCTCCAGG - Intronic
1088278845 11:108116862-108116884 TCCTGCCAACACCTGGATCTTGG + Intergenic
1089118854 11:116117825-116117847 GCCTTCCCACACAGGAATCCAGG - Intergenic
1089480622 11:118801778-118801800 CCCTTCCCTCAGATGGGTCCAGG + Intergenic
1089875167 11:121714267-121714289 TCCTTCCCTCACCTGGAATCTGG + Intergenic
1202820978 11_KI270721v1_random:69158-69180 TCCTGCCCACACAGGGAGTCAGG + Intergenic
1091591128 12:1843499-1843521 CCATTCCAGCACATGGATCCAGG - Intronic
1091921637 12:4309403-4309425 CCCTTCCCACACAGGGCTCCTGG + Intergenic
1093079674 12:14795029-14795051 TCCTTCCAACATTTTGATCCAGG - Exonic
1095881506 12:47141881-47141903 TCCTTCCCACCAAAGGACCCAGG + Intronic
1096047118 12:48572052-48572074 TCCCTCTCACACATGGTTCAAGG - Intergenic
1096914606 12:55017722-55017744 TCCTCCCCCCACATGGTTCCTGG - Intergenic
1103062619 12:117870974-117870996 TGCTTCCCAAACAGGGATCCTGG + Intronic
1103209310 12:119154858-119154880 TCCTTTCCACACTTGGTTCAAGG - Intronic
1103914211 12:124368247-124368269 TCCTTCCCACTCATGAAGGCCGG + Intronic
1104265079 12:127224278-127224300 TGCTTCTCACACATGAAACCAGG - Intergenic
1104755197 12:131264829-131264851 TCCTTCCCCCACCTGCATGCTGG + Intergenic
1106606156 13:31231214-31231236 TCCATCCCTCAGGTGGATCCAGG + Intronic
1106625793 13:31419571-31419593 TCCTGCCAACACATTGATCTTGG + Intergenic
1110407101 13:75162891-75162913 GGCTTCCACCACATGGATCCAGG + Intergenic
1114281948 14:21201249-21201271 TCTTTCCCACTCCTGCATCCTGG + Intergenic
1114417816 14:22556102-22556124 GTCTTCCCACACATGGCTCACGG - Intergenic
1115318470 14:32052007-32052029 TCCTGCACATACATGTATCCTGG - Intergenic
1116731476 14:48628094-48628116 TCCTACCCTCACTTGGATCAGGG + Intergenic
1116781363 14:49240993-49241015 ACCTTCCCAGACATAGATCTTGG - Intergenic
1116862679 14:50007179-50007201 TCCCTCCCACACATGCTCCCAGG - Exonic
1117498332 14:56327809-56327831 TCATTCCCACACTTGGAGCCAGG + Intergenic
1119372495 14:74159016-74159038 TCTTTCCAACACAGGGTTCCTGG + Intronic
1119635503 14:76270047-76270069 TCCTTTCCCCACTTGGCTCCTGG + Intergenic
1120340318 14:83211802-83211824 TCCTTCCCACATATTTCTCCAGG - Intergenic
1120916269 14:89713236-89713258 TCCTTCCAACACCTTGATTCTGG - Intergenic
1120997884 14:90430240-90430262 TCCTTCCAAAGCAGGGATCCAGG - Intergenic
1121078691 14:91090260-91090282 TCCATCCCAGTCATGGATCTCGG + Intronic
1121801175 14:96775364-96775386 CCCTTCCCACACTTTGATCTTGG - Intergenic
1121844670 14:97162247-97162269 TCCCTCCCACACGTGCATCTCGG - Intergenic
1122607060 14:102953732-102953754 TCCTTTCCACAAGTGCATCCTGG - Intronic
1122774004 14:104109215-104109237 TCATTCTCACACAGGCATCCGGG + Exonic
1124160066 15:27260178-27260200 CCCTGCCCACACATTGATCCTGG - Intronic
1125198560 15:37077186-37077208 TCCTTTCCTCACACGGATCAGGG - Intronic
1127550661 15:60034527-60034549 TCCTTTCCCCACAGGGCTCCAGG - Intronic
1128111434 15:65078589-65078611 TAGTTGCCACACAGGGATCCAGG + Intergenic
1131708853 15:95030518-95030540 TCCATCCCACACATAGACCCTGG - Intergenic
1132903790 16:2271973-2271995 GCCATCCCACACAGGGATCAGGG - Intergenic
1133164376 16:3936172-3936194 TCCTTCCCACACTTGTGCCCAGG - Intergenic
1135175135 16:20221303-20221325 AACTTCCCACACAAGGACCCTGG + Intergenic
1136672981 16:31874293-31874315 TTCTTCCCACACACCGAACCTGG - Intronic
1138416745 16:56876028-56876050 TCCTGCTGACACCTGGATCCCGG - Intronic
1138688549 16:58747496-58747518 TCCTTTTCACCCAGGGATCCAGG + Intergenic
1139662524 16:68430760-68430782 GCCATCACACGCATGGATCCAGG - Intronic
1140122253 16:72093837-72093859 ACCGTTCCACACTTGGATCCAGG + Exonic
1140263467 16:73400504-73400526 TCCTTCCCTCAGAAGCATCCCGG + Intergenic
1141087458 16:81106846-81106868 TCCTTTCCAAACACAGATCCGGG + Intergenic
1142877533 17:2861039-2861061 TCCTTTCCACACTTGGAACATGG + Intronic
1152117349 17:78396634-78396656 TCCTACCCACACAGGGCCCCAGG + Intronic
1152800922 17:82330288-82330310 TCCTGCCCTCACCTGGAGCCTGG + Intronic
1155293472 18:24364339-24364361 TCCAGCCTACACATAGATCCAGG + Intronic
1156461617 18:37324476-37324498 TCCTGCCCACACCTTGATCTTGG + Intronic
1158799903 18:60893966-60893988 CCCTTCCCACACATTGATTTCGG + Intergenic
1158837239 18:61343813-61343835 TGCTTCCCACTCATTGACCCTGG - Intronic
1160332637 18:78009358-78009380 GACTTCCCACACATGGAGCCAGG + Intergenic
1160981473 19:1818436-1818458 CCCTTCCCACCCATGGCCCCCGG - Intronic
1162830576 19:13282009-13282031 TCCTCCCCACGCCTGGCTCCTGG + Intronic
1163763188 19:19147922-19147944 TCCTCCCCACTCATGGAGCTGGG - Intronic
1166715184 19:44962442-44962464 CCCTGCCCACAGCTGGATCCTGG - Intronic
1168310164 19:55456075-55456097 TCCTTCAGACCCAGGGATCCAGG - Intronic
926111431 2:10186821-10186843 CCCTCCCCTCACATGGAGCCAGG + Intronic
926708850 2:15859096-15859118 TCCTATCCACACTGGGATCCAGG + Intergenic
926905712 2:17803652-17803674 TCCTTCCCACACATTGCTTGTGG - Intergenic
928662821 2:33520767-33520789 TCCATCCCACTCCTGAATCCAGG + Intronic
931139285 2:59439059-59439081 TCCTTCTGTGACATGGATCCTGG - Intergenic
931447439 2:62338500-62338522 TCCTTCCAACCCCTGGATCTGGG - Intergenic
931607472 2:64066547-64066569 TCCTTCCCACACCTCAATCCAGG - Intergenic
931721609 2:65071196-65071218 TCCTTCCTCCACAGGTATCCAGG - Intronic
932192665 2:69754020-69754042 CTCTTCCCACAGATGGATGCTGG - Intronic
934474644 2:94586296-94586318 CCCTTCCCATCCATGGAACCTGG + Intergenic
934582221 2:95452164-95452186 TCATTCCCATGCATGGGTCCTGG - Intergenic
934597229 2:95624550-95624572 TCATTCCCATGCATGGGTCCTGG + Intergenic
934842657 2:97638445-97638467 TCATTCCCATGCATGGTTCCTGG - Intergenic
937480157 2:122250066-122250088 ACCTGCCCACACATTGATCTTGG + Intergenic
937668381 2:124513161-124513183 TCCTGCCAACATCTGGATCCTGG - Intronic
937936248 2:127248019-127248041 TCCTTCCAACATTTTGATCCAGG + Intergenic
938581209 2:132648063-132648085 TGCCTCCCACACATAGATACAGG - Intronic
941484216 2:166059430-166059452 TCATTCACATTCATGGATCCTGG - Intronic
942879660 2:180843994-180844016 TTCTTCCCAGACATGTCTCCTGG - Intergenic
946361556 2:219222122-219222144 TCCTTCCCACACGCTGCTCCCGG + Exonic
946885078 2:224215142-224215164 TCCTTCCCACACCTTGATCTTGG - Intergenic
1173972818 20:47165668-47165690 TCCTTGACACACATGGGCCCAGG - Intronic
1174522897 20:51145488-51145510 TCCATCACGCACATGCATCCTGG + Intergenic
1175525874 20:59632990-59633012 TCCGTCCCCCACCTTGATCCTGG + Intronic
1177379909 21:20326595-20326617 TCCTTCCCACACCTGGATCTTGG + Intergenic
1179186614 21:39089819-39089841 CCCTGCCCACACCTTGATCCTGG + Intergenic
1180712509 22:17848939-17848961 TCCTTTCCACACATGGCTCTGGG - Intronic
1182319597 22:29470148-29470170 TCCTCCCCAGACATTGGTCCTGG - Intergenic
950809958 3:15641645-15641667 TCCTTCCCTCACATGACCCCAGG + Intronic
951900958 3:27657118-27657140 TCCTACACACACTTGGATTCTGG - Intergenic
952848990 3:37712352-37712374 TCCTTCCCACTTAGGGAACCAGG + Intronic
954585623 3:51733733-51733755 TACTTCCTGCACATGTATCCTGG - Intergenic
954795685 3:53160543-53160565 TCCTTTCCAGACATGGAACTTGG - Intronic
954874118 3:53789930-53789952 TCCTTCCCACACATGGATCCAGG - Intronic
956286424 3:67614877-67614899 TCCTTCCTTCACATGGATTTTGG + Intronic
958036222 3:88173098-88173120 TCATTCCCACACATGTTCCCTGG - Intergenic
958667899 3:97163463-97163485 TCATTCCCACACATGTTTCCAGG + Intronic
958842978 3:99231199-99231221 ATCATCCCACACATGGAACCTGG - Intergenic
960893806 3:122479854-122479876 TCCTTCCCACAAATGTATATAGG + Intronic
962382971 3:134911877-134911899 GCCATCCCACCCAGGGATCCTGG + Intronic
962472374 3:135722792-135722814 TCCTTCCAACAAATGGAACTAGG - Intergenic
962923318 3:139970265-139970287 TCCCTGCCACACAGGGTTCCTGG + Intronic
967091496 3:186138432-186138454 GCCTTCCCAGAGATGGATGCTGG - Intronic
976980420 4:91219039-91219061 TCCTCCCCACACATAGATTCAGG + Intronic
977918852 4:102622325-102622347 ACTTAGCCACACATGGATCCAGG + Intergenic
985508765 5:299984-300006 TCCTTCTCTCACATGGGCCCAGG + Intronic
985739359 5:1605932-1605954 TCCTTCTCTCACATGGGCCCAGG - Intergenic
987155805 5:15088856-15088878 TACTTCCCACACATTAATCTGGG - Intergenic
988868895 5:35366479-35366501 TCCTGCCGACACATTGATCCAGG + Intergenic
990324271 5:54659557-54659579 TCCTTACCAGACATGGGTGCAGG - Intergenic
992492168 5:77255725-77255747 ACCTTCCCACACATGCCTCCAGG - Intronic
993398607 5:87421386-87421408 TCATTCCCACACATGTTTCCTGG + Intergenic
994243828 5:97455962-97455984 TCCTTTCCTCTAATGGATCCAGG + Intergenic
997589639 5:135064848-135064870 TCCTTCCCATACCTGAACCCAGG - Intronic
999635530 5:153617992-153618014 TCCACCCCACACATAAATCCAGG - Intronic
1001107293 5:168865567-168865589 TCTCTCCCATGCATGGATCCTGG - Intronic
1002824827 6:763358-763380 TCCTTCCTACCCATGCTTCCTGG - Intergenic
1002888560 6:1316025-1316047 TCCTTCCCACCTCTGGTTCCAGG + Intergenic
1003136147 6:3435960-3435982 CCCTGCCCACACCTGGATCTAGG + Intronic
1003601769 6:7524270-7524292 TCCTTCCCACAAAAGAATTCTGG + Intergenic
1004273311 6:14213417-14213439 TCCTTCCAACACCTGGAGGCTGG - Intergenic
1005143388 6:22660161-22660183 TCATTCCCACAAATACATCCAGG + Intergenic
1006443067 6:34063903-34063925 TCCTTCCCGCTCCTGGAGCCAGG - Intronic
1007916856 6:45569259-45569281 TCATGCCCACACATGTTTCCAGG - Intronic
1009517526 6:64639035-64639057 TCCTGCCCACACATGGATTTTGG - Intronic
1011767044 6:90633085-90633107 TCCATGCAACAAATGGATCCAGG + Intergenic
1013193869 6:107828218-107828240 TCATTCCACCTCATGGATCCTGG + Intergenic
1013887015 6:114980225-114980247 TCCTGCTCACACATACATCCAGG - Intergenic
1015166757 6:130207624-130207646 TCCTTCCCACTCATGGGTGCTGG - Intronic
1016060630 6:139626419-139626441 TCCTTTCCTAACAAGGATCCTGG + Intergenic
1019153300 6:170023287-170023309 TCCGCCCCGCACGTGGATCCCGG + Intergenic
1019299024 7:294221-294243 TCCCTCCCACAGATGGAAGCAGG + Intergenic
1019477582 7:1251467-1251489 CCCTGCCCACACCTGGATCTCGG + Intergenic
1020578133 7:9960307-9960329 TCATTCACACACATGGCTCGTGG + Intergenic
1022895473 7:34746769-34746791 TCTTTCCCATTCTTGGATCCAGG - Intronic
1024263189 7:47587119-47587141 TCCTCCACCCACATGGCTCCAGG - Intergenic
1028457627 7:91055958-91055980 TCCTTCCCACAAATTAATGCCGG + Intronic
1029157109 7:98525218-98525240 TCCTGCCCACACCTTGATCTTGG + Intergenic
1029972976 7:104807369-104807391 TCCTGCCGACACCTCGATCCTGG + Intronic
1031597551 7:123665524-123665546 CCCTTCCCTCACATGGAATCAGG - Intergenic
1033553233 7:142466371-142466393 TCCTTCCCTCACAGGTGTCCTGG + Intergenic
1033557725 7:142503300-142503322 TCCTTCCCTCACAGGTGTCCTGG + Intergenic
1033560180 7:142523357-142523379 TCCTTCCCTCACAGGTGTCCTGG + Intergenic
1033910939 7:146262410-146262432 TCCTTCCCCTAGATGGTTCCAGG + Intronic
1035293367 7:157854031-157854053 CCCTGCCCACACATTGACCCTGG + Intronic
1036604787 8:10295401-10295423 TCCTTCTCACACAGGGACCTGGG + Intronic
1039575393 8:38619855-38619877 TCCTTCCAACACAGGCATACTGG - Intergenic
1041596028 8:59654159-59654181 TCCTTAGCACACATGGAACATGG + Intergenic
1042201367 8:66282118-66282140 TAATTCACACACATGGACCCAGG + Intergenic
1044958174 8:97503430-97503452 TCCTCCATACACATGGGTCCAGG - Intergenic
1048269533 8:133017509-133017531 TCCCTTCTATACATGGATCCAGG - Intronic
1048381583 8:133870355-133870377 TCCTCCCCACACACGTACCCTGG + Intergenic
1049383949 8:142331529-142331551 TCCTTCCCACCCATGAAACCCGG + Intronic
1052855410 9:33403462-33403484 CCCTTCCCACCCATGGAGCCTGG - Intergenic
1053683423 9:40499805-40499827 CCCTTCCCACCCAGGGAACCTGG - Intergenic
1053933403 9:43128120-43128142 CCCTTCCCACCCATGGAACCTGG - Intergenic
1054280292 9:63125123-63125145 CCCTTCCCACCCAGGGAACCTGG + Intergenic
1054296526 9:63335303-63335325 CCCTTCCCACCCAGGGAACCTGG - Intergenic
1054394544 9:64639808-64639830 CCCTTCCCACCCAGGGAACCTGG - Intergenic
1054429193 9:65145007-65145029 CCCTTCCCACCCAGGGAACCTGG - Intergenic
1054501191 9:65876528-65876550 CCCTTCCCACCCAGGGAACCTGG + Intergenic
1057367536 9:94437074-94437096 TCCATCCCACACTTGGAGCCTGG - Intronic
1057509273 9:95664047-95664069 TCCTTCCTGCACCTGGTTCCAGG + Intergenic
1057655792 9:96950979-96951001 TCCATCCCACACTTGGAGCCTGG + Intronic
1058226099 9:102365700-102365722 TCCCACCAACACATGGACCCAGG - Intergenic
1059343154 9:113610943-113610965 ACCCTGCCACACCTGGATCCTGG - Intergenic
1059891999 9:118814197-118814219 TCATACCCACTCATGGACCCAGG + Intergenic
1059984810 9:119811723-119811745 TCTTTCCCACAAATGAATTCTGG + Intergenic
1060281909 9:122220663-122220685 TCCTTCACACGCCGGGATCCAGG - Intronic
1185521013 X:739746-739768 TCCATTCCAAACATGCATCCCGG + Intergenic
1185746097 X:2574688-2574710 CCCTGCCCACACCTGGATCTCGG + Intergenic
1186044133 X:5516009-5516031 TCCTGCCCACACCTCGATCTTGG - Intergenic
1186371672 X:8953245-8953267 CCCTGCCCACACCTGGATCTCGG - Intergenic
1186429444 X:9492176-9492198 TCCTTCCCACATGGGGAGCCAGG - Intronic
1187053128 X:15713967-15713989 TCCTTTCCAAAGATGGATTCAGG - Intronic
1192222846 X:69209150-69209172 TCCTGCCCACAGTTGGACCCAGG + Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1192539103 X:71953195-71953217 TACTTCCCAAACAGGGATCCAGG - Intergenic
1196708460 X:118738161-118738183 TCCTTCCCACAGTTGGACCTTGG + Intronic
1197284642 X:124581906-124581928 CGCATCCCACACATGCATCCCGG - Intronic
1197648785 X:129043086-129043108 TCCTGCTCAAACCTGGATCCAGG + Intergenic
1199383540 X:147198235-147198257 TACTTCCCAAACATGCATACTGG + Intergenic
1202270932 Y:23073408-23073430 TCCTTCCCACACTAGGATAGCGG - Intergenic
1202295094 Y:23347274-23347296 TCCTTCCCACACTAGGATAGCGG + Intergenic
1202344614 Y:23908346-23908368 TCCTTTCCACAAATGCCTCCCGG + Intergenic
1202423927 Y:24707152-24707174 TCCTTCCCACACTAGGATAGCGG - Intergenic
1202446862 Y:24962933-24962955 TCCTTCCCACACTAGGATAGCGG + Intergenic
1202526154 Y:25761737-25761759 TCCTTTCCACAAATGCCTCCCGG - Intergenic