ID: 954878416

View in Genome Browser
Species Human (GRCh38)
Location 3:53818284-53818306
Sequence CTGTCTGAGGGGATGGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954878409_954878416 16 Left 954878409 3:53818245-53818267 CCTCACTGGAAGATTCACGGCAT 0: 1
1: 0
2: 0
3: 1
4: 57
Right 954878416 3:53818284-53818306 CTGTCTGAGGGGATGGTGTTTGG 0: 1
1: 0
2: 0
3: 32
4: 222
954878406_954878416 26 Left 954878406 3:53818235-53818257 CCCGTGCTGGCCTCACTGGAAGA 0: 1
1: 0
2: 0
3: 31
4: 197
Right 954878416 3:53818284-53818306 CTGTCTGAGGGGATGGTGTTTGG 0: 1
1: 0
2: 0
3: 32
4: 222
954878407_954878416 25 Left 954878407 3:53818236-53818258 CCGTGCTGGCCTCACTGGAAGAT 0: 1
1: 0
2: 1
3: 22
4: 265
Right 954878416 3:53818284-53818306 CTGTCTGAGGGGATGGTGTTTGG 0: 1
1: 0
2: 0
3: 32
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954878416 Original CRISPR CTGTCTGAGGGGATGGTGTT TGG Intronic
900281858 1:1874917-1874939 CAGACAGAGGGGATGGTTTTGGG + Intronic
901480283 1:9520445-9520467 CTGGCTGAGGGGATAGAGGTGGG - Intergenic
901931588 1:12599364-12599386 CTTTCTGTGGGGCTGGTGCTTGG - Intronic
904316490 1:29669547-29669569 CTGTTTGAGCTGATCGTGTTTGG - Intergenic
904657700 1:32061759-32061781 CTGACTGAGGAGCTGGTGTTAGG + Intergenic
904741939 1:32684200-32684222 CTGGCTGAGGGGATGGTGGGAGG - Exonic
904888031 1:33756484-33756506 CTGTCTGAGGAGGTGGCCTTTGG + Intronic
905280583 1:36846568-36846590 CTGTCTGGGAGGATGTTGTCAGG - Intronic
905533590 1:38701294-38701316 TTGACTGTGTGGATGGTGTTTGG + Intergenic
906017189 1:42592308-42592330 GGGTCTGAGGGGAGTGTGTTTGG + Intronic
906167543 1:43698122-43698144 CTGTTTGAGGACATGGTGATGGG - Intronic
907052615 1:51339913-51339935 ATGTCTAAGGTGATGGTATTAGG + Intronic
907942590 1:59103816-59103838 CTGTCAGAGGGGAGGGGGCTAGG + Intergenic
908172242 1:61516842-61516864 CTGTCGGAGTGGTTAGTGTTTGG + Intergenic
912133694 1:106633320-106633342 CTCTCTGAGTGGCTGGTGTATGG - Intergenic
912468070 1:109887566-109887588 CTGGCTGAGTGATTGGTGTTGGG + Intergenic
915247843 1:154568674-154568696 CTCTCTGAGGGGATGGGGAGGGG + Intronic
916457207 1:164983160-164983182 CAGTCTGTGGGGCTGGTGTGTGG - Intergenic
916576249 1:166069790-166069812 CTGTCTGACTGGAGGGTGCTGGG - Intronic
920789028 1:209071065-209071087 CTGTCAGAGTGGGTGGAGTTGGG + Intergenic
921709603 1:218360507-218360529 CTGTCAGTGGGGATGGGGTAGGG + Intronic
922855195 1:228769123-228769145 CAGACTGAGGGTATGGGGTTGGG - Intergenic
922892905 1:229075237-229075259 CACTCTGAGGGGCTGGTGCTTGG + Intergenic
922979505 1:229813744-229813766 CTCTCTGAGAGGAAGGTGCTAGG - Intergenic
923034665 1:230277265-230277287 CTGTCTGATGGGATTGTGGTTGG - Intronic
1062810054 10:456394-456416 CTGCCTGAGGGGAGGCTGTGAGG + Intronic
1064950868 10:20848706-20848728 GTGTTGGAGGGGATGGTTTTAGG - Intronic
1066319677 10:34289186-34289208 TTTTTTGAGGGGAGGGTGTTGGG + Intronic
1067090173 10:43262420-43262442 CAGTCTGGGGGGCTGGTGTCTGG - Intronic
1069740230 10:70682677-70682699 AGGTCTGAGGGGATGGTGGCAGG + Intronic
1070554412 10:77516800-77516822 CTGTGTGAGCGGCTGGTGTGGGG + Intronic
1070682650 10:78459689-78459711 GTGAGTGAGGGGATGGGGTTAGG + Intergenic
1071508163 10:86245334-86245356 CTGTCTGAGGGGTAGGTGCTGGG - Intronic
1071919688 10:90335417-90335439 CTGTCTGAGGGTGGGATGTTGGG + Intergenic
1072243241 10:93517468-93517490 CTCTCTGAGGAGATGGCATTTGG + Intronic
1073452998 10:103620405-103620427 CTGACAGAGGGGAAAGTGTTGGG - Intronic
1074291212 10:112139265-112139287 CTGGCAGAGGGGATGGCGTGAGG - Intergenic
1074403849 10:113164170-113164192 CAGTCTGATGGGATGGTATTTGG - Intronic
1076480748 10:130783745-130783767 CTGTGTGAGGGGGTGCTGGTGGG + Intergenic
1078405601 11:11067699-11067721 CTCTCTGGTGGGATGGGGTTGGG + Intergenic
1080034684 11:27699774-27699796 CTGACTGAGGGGAGGGTGCTGGG - Intronic
1082931429 11:58610882-58610904 ATGTCTGAGGGGATTTTATTTGG - Intronic
1083396403 11:62395620-62395642 TTGTCAGAGGTGATGGTGTGTGG + Intergenic
1083679103 11:64343092-64343114 CAGGCTGAGGGGAAGGAGTTTGG + Intronic
1085121133 11:73968348-73968370 ATGTCTGCTGGGATGATGTTGGG - Exonic
1086930973 11:92692662-92692684 CTGTCTGAAAGGATGGTGAAGGG + Intronic
1088107494 11:106223410-106223432 CTGCCTGAGGGGAAGGTCTGGGG - Intergenic
1088880538 11:113970255-113970277 GGGTCTGAGGGCATGGGGTTTGG - Intergenic
1091195572 11:133728018-133728040 CTGTTTTGGAGGATGGTGTTGGG - Intergenic
1092045331 12:5428468-5428490 CTGTCTGGGTGGATGGGGGTGGG + Intergenic
1092068354 12:5611954-5611976 CTGTTTCAGGGGATGCTTTTAGG - Intronic
1092112130 12:5971302-5971324 GTGGCTGAGGGGCTGGTTTTGGG - Intronic
1093651694 12:21653408-21653430 ATGTGTGAGGGGATAGTTTTGGG - Intronic
1093958566 12:25250111-25250133 CTGTTTGAGGTTATTGTGTTTGG - Intronic
1094584943 12:31769112-31769134 CTGGCTTAGGGGATGTGGTTAGG + Intergenic
1097108998 12:56644223-56644245 CTATGTGAGGGAATGCTGTTAGG - Intronic
1097143106 12:56919722-56919744 CTGTCTGAGGGTAAGGGGCTAGG + Intergenic
1097682210 12:62659441-62659463 CTGCCTGAGAGGATGGTGTGAGG + Intronic
1100279899 12:93108313-93108335 CTGTCTGAGCCCATGGGGTTGGG - Intergenic
1101834208 12:108283851-108283873 CTGTCTGAGGAGATGGCATTTGG + Intergenic
1103627050 12:122227243-122227265 CTGTCTGATGAGCTGGTGTGGGG - Intronic
1104831146 12:131752618-131752640 CTTACTGAGGGGATGGTTTCCGG + Intronic
1105606605 13:21931179-21931201 CAGTCTGAAAGGATGGTTTTTGG + Intergenic
1106783886 13:33087849-33087871 ATGGGTGAGGGGATGGTCTTGGG + Intergenic
1108592420 13:51923490-51923512 CTGCCTGAGGGTCTGGTGCTTGG - Intergenic
1111644985 13:91021521-91021543 GTGTCTGTGGTGATGGTGGTGGG - Intergenic
1112332302 13:98485930-98485952 CTGTCTTAGTGGCTGGCGTTGGG - Intronic
1112577079 13:100645382-100645404 CTGCCTGAGAGGGTGGGGTTTGG - Intronic
1113670614 13:112173123-112173145 CTGACCCAGGGGAGGGTGTTGGG + Intergenic
1113872003 13:113565292-113565314 GTGTCTGAGGGGACGGTCTGTGG - Intergenic
1113872114 13:113565744-113565766 GTGTCTGAGGGGACGGTCTGTGG - Intergenic
1114183305 14:20382776-20382798 CTGGCAGAGGGGCTGGTGCTGGG - Intronic
1115258039 14:31423149-31423171 CTGTCTGAGTGGATGCAGTTAGG + Intronic
1116787756 14:49306952-49306974 ATGTGTGAGGGGTTGGTATTGGG - Intergenic
1117287700 14:54302827-54302849 CAGTCACAGGGGAAGGTGTTGGG + Intergenic
1118362147 14:65065791-65065813 CTGTCTTAGGGGTTATTGTTTGG - Intronic
1119683987 14:76615665-76615687 CTGTCTTAGGGGCTGCTGTGAGG + Intergenic
1119756998 14:77126252-77126274 CTGTCTGAAGGGGTGATTTTAGG - Intronic
1120503684 14:85327459-85327481 CTTTCTTAGGGGATGCTTTTGGG - Intergenic
1121027609 14:90628059-90628081 CTACCTGAGCGCATGGTGTTAGG + Intronic
1121576528 14:94993298-94993320 CTGACTGAGAGGCAGGTGTTTGG - Intergenic
1122900009 14:104778527-104778549 CAGGCTGAGGGGCTGGGGTTGGG - Intronic
1123116639 14:105897802-105897824 CTGGCTGGTGGGGTGGTGTTTGG + Intergenic
1126504197 15:49384425-49384447 CTGTCTGTGGGGATGGGGTGGGG + Intronic
1128702526 15:69814584-69814606 CTGTGTGCTGGGAAGGTGTTAGG - Intergenic
1128911809 15:71522437-71522459 CTCTCTGAAGGTATGGGGTTAGG + Intronic
1130443285 15:83976414-83976436 CAGTCGTAGGGGATGGTTTTGGG + Intronic
1133730519 16:8574680-8574702 CAGTCTGAGATGATGGTGTGTGG - Intronic
1134188409 16:12101913-12101935 CTGTCTGAGGGTAGGGGGCTAGG - Intronic
1136277378 16:29186986-29187008 CTGTATGGGGGGATGGCGTGAGG + Intergenic
1137354165 16:47743309-47743331 CTGTCTGAGGGGAGGGGATGGGG - Intergenic
1137581713 16:49637614-49637636 CCGTCAGAGGGGTTGGCGTTGGG + Exonic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1141049195 16:80745310-80745332 CTGTCATAGGGAATGGTGATCGG - Intronic
1141162452 16:81638453-81638475 CTCTCTGAGGGGATGGTGCCTGG + Intronic
1141319959 16:82999003-82999025 GTGTCTGAAGGGATGTTCTTGGG - Intronic
1142382281 16:89739652-89739674 CTGGCTGTGGGGATAGTGTGGGG + Intronic
1142630146 17:1220351-1220373 CTGTCTGAGGGGAGGCTGCCTGG - Intronic
1143537463 17:7549695-7549717 CTGTGTGAGGGGTTTGTGCTGGG + Intronic
1145866046 17:28242275-28242297 GTGCCAGAGGGCATGGTGTTGGG + Intergenic
1146548075 17:33756296-33756318 CCATCTGAGGGGCTGGTGTTTGG - Intronic
1146659291 17:34653687-34653709 CTGGAGGAGGGGATGGGGTTGGG - Intergenic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147754622 17:42760579-42760601 GTGTCTGAAGGGAAGGTATTTGG + Intronic
1149107998 17:52992373-52992395 CTGTATCAGGGGTTGGTGTTGGG + Intergenic
1151383619 17:73742074-73742096 CTTTCTGAGGTGCTGGGGTTGGG - Intergenic
1151718207 17:75842323-75842345 CTGGCTCAGGGGAGGGGGTTTGG - Intronic
1151909188 17:77070371-77070393 CTGTCTGACGGTGTGGTGCTTGG - Intergenic
1153677105 18:7465519-7465541 TTGTGGGAGGGGATGGTTTTGGG + Intergenic
1155463378 18:26108864-26108886 CTGTCAGCTGGGATGTTGTTGGG + Intergenic
1156564151 18:38164508-38164530 CTGTCTCAGGAGGTGGTGGTGGG + Intergenic
1159795460 18:72837886-72837908 CTGTCATAGAGGATGGTGATGGG - Intronic
1159795467 18:72837945-72837967 CTGTCATAGGGGATGGTGATGGG - Intronic
1159795478 18:72838004-72838026 CTGTCATAGGGGATGGTGATGGG - Intronic
1159795488 18:72838063-72838085 CTGTCATAGGGGATGGTGATGGG - Intronic
1161043276 19:2121375-2121397 CTGTCTCAGGAGCAGGTGTTGGG - Intronic
1161086484 19:2337920-2337942 CTCTCTGTGGGGATGGGATTGGG + Intronic
1161990494 19:7681571-7681593 CTGCCTGAGGGCTTGGGGTTGGG + Intronic
1163687018 19:18717490-18717512 CCTTCTGAGGGGACAGTGTTTGG - Intronic
1163752212 19:19084612-19084634 CAGTCTGATGGGATGGGGATGGG - Intronic
1165821538 19:38679513-38679535 ATGTCTGGGGGGAGTGTGTTGGG - Intronic
1166729669 19:45052006-45052028 GTGTGTGAGGGGGTGGGGTTTGG + Intronic
1167131566 19:47589612-47589634 ATGGCGGATGGGATGGTGTTGGG + Intergenic
1168504395 19:56921113-56921135 CCCTCTAAGGTGATGGTGTTAGG + Intergenic
926692695 2:15748204-15748226 CTGTCTCAGGGGGTGGGGTGGGG + Intergenic
927322767 2:21767043-21767065 TTATGTGAGGAGATGGTGTTTGG + Intergenic
929103435 2:38339977-38339999 CTGTATGAGGGCAGGGTGTTGGG - Intronic
931841370 2:66153170-66153192 CTGTGTATGTGGATGGTGTTGGG + Intergenic
932148625 2:69347367-69347389 CTTTCTGATGGGATTGTGGTAGG - Intronic
932419198 2:71591658-71591680 CTGTCTGAGTGCCTGCTGTTTGG + Intronic
932598757 2:73110381-73110403 CTGTCAGTGGGCATGCTGTTAGG + Intronic
936058947 2:109282036-109282058 GTGTCAGAGGGGATGCTGGTGGG + Intronic
936377545 2:111954794-111954816 CTGACTGTGGGGATTGTGCTGGG + Intronic
937930554 2:127201721-127201743 CTTCCTGAGAGGAGGGTGTTGGG - Intronic
940594759 2:155776304-155776326 CTGTCAGAGGGTAGGGGGTTAGG + Intergenic
940808999 2:158221711-158221733 ATGTCTGTGGCGATGGTGCTTGG - Intronic
941318238 2:164021850-164021872 CTGCCTGAAGGCATAGTGTTTGG - Intergenic
942948688 2:181698229-181698251 CTGTCAGAAGGAATAGTGTTGGG - Intergenic
943444153 2:187962657-187962679 AGGTATGAGGGGATGGTGGTGGG + Intergenic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
947917286 2:233841185-233841207 CTGTGTGTGGGGTTGGTCTTTGG + Exonic
947929943 2:233956163-233956185 CAGGCTGGGGGGATGGTCTTGGG - Intronic
1168823515 20:793268-793290 CTGTCTGAGGGGAAAGTTTGGGG - Intergenic
1170904949 20:20505835-20505857 ATGTCTGAGGGTATGGTCTCAGG - Intronic
1171491754 20:25524400-25524422 CTGTAGGAGGGGATGGAGCTGGG + Intronic
1173095594 20:40025090-40025112 CAGTGTGGGGGGATGGTTTTGGG + Intergenic
1174011494 20:47453375-47453397 CTGTCTTCTGGGATGGTTTTAGG - Intergenic
1175896777 20:62339957-62339979 CTGTCTGAGGCGTTGGTTTAAGG - Intronic
1178714271 21:34949099-34949121 CTGTTTGGGGGGATGGGGTAGGG - Intronic
1182980109 22:34661824-34661846 CTGTCAGTGGGTATGGTGTGGGG - Intergenic
1183749866 22:39713706-39713728 CTGTCTGAGGGGAAGAGGTGGGG + Intergenic
1184121208 22:42451718-42451740 CTGCTTCAGGGGATGGTGTGGGG - Intergenic
1184413264 22:44337981-44338003 CTTTCTGAGAGGGTGGTGCTTGG + Intergenic
1185012232 22:48320765-48320787 CTGGCGGAGGAGATGGTGTCAGG - Intergenic
1185068019 22:48641635-48641657 GTGTGTGAGGGGAGGGTGTGCGG - Intronic
949862741 3:8521404-8521426 CTGTCAAAGGGGATGGAGTTGGG - Intronic
950494780 3:13327258-13327280 CTGTCTGGGGCCATGGTGGTGGG - Exonic
950616808 3:14166449-14166471 CTGCCTGAGAGGATAGTGATGGG - Intronic
952074636 3:29681500-29681522 CTGTCTGGGGGGATTGTGTGGGG - Intronic
952076584 3:29704197-29704219 CTGTGTGGGGAGATGGTTTTGGG - Intronic
953674864 3:44993078-44993100 CTGGCTGAGGGGCTGGGGGTGGG + Intronic
954134125 3:48574356-48574378 CTGTCTAGGGGGATGGTGGGTGG - Intronic
954878416 3:53818284-53818306 CTGTCTGAGGGGATGGTGTTTGG + Intronic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
960360252 3:116702492-116702514 CTGTCTCTGGGGATGCTGGTTGG - Intronic
963045526 3:141100238-141100260 CTTTCTGAGGTGCTGGGGTTAGG - Intronic
964752897 3:160068589-160068611 CCTTCTAAAGGGATGGTGTTAGG + Intergenic
965651836 3:170942428-170942450 CTGGGTGAGGGGGTGGTGTATGG + Intergenic
968760820 4:2442135-2442157 CTGAGTGTGGGGATGGGGTTTGG + Intronic
969448380 4:7258295-7258317 CTGTCGGTGGGTGTGGTGTTAGG - Intronic
970323760 4:14901630-14901652 CTGTCTGTGGGGCAGGGGTTGGG + Intergenic
975033619 4:69655679-69655701 CTGTCTGAGTGGAGTGTGTTAGG - Intergenic
975071027 4:70138635-70138657 TTGTCTGATGGGGTGGTCTTGGG - Intronic
975294291 4:72714557-72714579 ATGGTTGAGGGGTTGGTGTTGGG - Intergenic
977414758 4:96719088-96719110 CTGTCAGAGGGGGTGTTGTTGGG - Intergenic
981679268 4:147376474-147376496 CTGTCTGAGGAGGTGTTCTTAGG - Intergenic
981877188 4:149560941-149560963 CTGTGTGAAGGGTTGCTGTTGGG - Intergenic
981908841 4:149954499-149954521 CTGCCTGTGGGGAGGGTGTCAGG - Intergenic
982121798 4:152150258-152150280 CTGCCCGAGGTGATGGTATTGGG - Intergenic
983121788 4:163895398-163895420 CTGGCTGAAAGGATGATGTTTGG + Intronic
984508752 4:180653824-180653846 GTGTCTGAAGGGATGGAGTCTGG - Intergenic
984836595 4:184028301-184028323 CTAGCTGAGGGGATGGTCTTGGG - Intergenic
986355117 5:6916183-6916205 CTGTCTGAGTGGAGGATGTTGGG + Intergenic
986411700 5:7487715-7487737 TTGTCTGAGGTCATGGTGCTGGG + Intronic
986811856 5:11368387-11368409 TTGGCTGTGGGGTTGGTGTTGGG + Intronic
988716997 5:33838062-33838084 CTTTCTGTGGGGATGTTGTGGGG - Intronic
990480118 5:56202138-56202160 CTGTCAGAGGGGGTGGTGTGGGG + Intronic
993498945 5:88641428-88641450 CTGTCTGAGGTGATGTAGTTAGG + Intergenic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1002964774 6:1952968-1952990 CTGACTGAGGAGGTGATGTTTGG - Intronic
1004511269 6:16286116-16286138 CTGTCCAAGGGGATGGTGCCAGG + Intronic
1004848271 6:19669734-19669756 CTGTCTGAGGTGAAGGGCTTAGG - Intergenic
1005144533 6:22673144-22673166 TTGTCTGAGGGGATGGCCATGGG - Intergenic
1005817137 6:29562696-29562718 CTGGCTGACGGGATGCTCTTGGG + Intronic
1005869511 6:29964100-29964122 CTGTCTGAGGGTAGGGGGCTAGG + Intergenic
1005880906 6:30060266-30060288 CTATCAGAGTGGATGGTGGTGGG + Intronic
1006174803 6:32115493-32115515 TTGTTTGAGGGGATTGTGTGAGG - Exonic
1006272994 6:32978571-32978593 GGGTTTGAGGGGATGGTTTTTGG + Intronic
1010484796 6:76397306-76397328 CTGTCTGAGGGGATAGCTTTAGG - Intergenic
1013174915 6:107668875-107668897 CTCTCAGAGGGGCTGGTATTTGG - Intergenic
1016161147 6:140881440-140881462 CTGTATGAGGGGAGGTTTTTTGG - Intergenic
1017061402 6:150488391-150488413 TTGACTGCTGGGATGGTGTTGGG - Intergenic
1017694900 6:157004728-157004750 CGGTGTTAGGGGAGGGTGTTGGG + Intronic
1017878917 6:158546246-158546268 CAGCCTGAGGGGAGGGTATTTGG - Intronic
1018745646 6:166760048-166760070 TTGTTTGAGGGTGTGGTGTTGGG + Intronic
1018913869 6:168120959-168120981 CTGCCTGAGGTGCTGGTGCTGGG + Intergenic
1019155787 6:170038059-170038081 CTGTCACAGGGGAGGGTGTGGGG + Intergenic
1019811340 7:3167374-3167396 CTGTGTGTGGGGATGGGGATGGG - Intronic
1022427029 7:30278754-30278776 CTGACTGAAGGGATGGGGATTGG - Intergenic
1022550849 7:31237650-31237672 CTGTCTGAGGGTGTGGCGGTGGG - Intergenic
1024441361 7:49422090-49422112 GTGCCTGCAGGGATGGTGTTTGG - Intergenic
1028029931 7:85898010-85898032 CTGTCTGAGGAGATGACATTTGG + Intergenic
1030293335 7:107893607-107893629 CTTTCTGAGGAGATGATGTCTGG + Intronic
1032086433 7:128886379-128886401 CTGGCTGAGGGGAGGGAGGTGGG + Intronic
1032274762 7:130444923-130444945 AGGTCTGAGGGGAGGGTGTTGGG - Intergenic
1032896512 7:136256927-136256949 CTGCCTGAAGGGAGGGAGTTTGG + Intergenic
1033896157 7:146073287-146073309 ATGTCTTATGTGATGGTGTTTGG - Intergenic
1034196977 7:149255500-149255522 CTGTCTGGGGGGATGGGAGTGGG + Exonic
1034383535 7:150719717-150719739 CTGTCTCTGGGGATGGTCTCTGG + Intronic
1034671008 7:152858493-152858515 CTTTCTTAGGGGTTGGGGTTTGG + Intergenic
1034873075 7:154700909-154700931 CTGTCTGATGGGAAGGTCTCTGG - Intronic
1034931470 7:155167135-155167157 TTGGCTGAGGGGCTGGTGTCTGG - Intergenic
1036139024 8:6189292-6189314 CTGTTTGAGGGTATGGGGTGAGG + Intergenic
1037778324 8:21850135-21850157 ACCTCTGAGGCGATGGTGTTAGG + Intergenic
1037807990 8:22069111-22069133 ATGTGTGAGGGGAGGGAGTTAGG - Intronic
1038559834 8:28564399-28564421 TTGTATGAGAGGAAGGTGTTAGG - Exonic
1039367120 8:36940770-36940792 CTGTCTGAGTTGAAGGTATTTGG - Intergenic
1039901151 8:41753421-41753443 CTGACTGAGGGGAAGGGGTCTGG - Intronic
1041201649 8:55455289-55455311 CTGGCTGAGAAGATGGTGTCTGG - Intronic
1041342302 8:56858680-56858702 GTGTATGAGGGGATGGTGTGGGG - Intergenic
1041373470 8:57189290-57189312 TTGTTGGAGGGGATGGTTTTGGG - Intergenic
1043844487 8:85148906-85148928 AAGTCTGAGGGGCTGGTATTGGG - Intergenic
1045478370 8:102572830-102572852 CTGTTAGAGGGAATGGTGTTGGG + Intergenic
1049212091 8:141391632-141391654 CTGGCTGAGGGGATGGGCTGGGG - Intergenic
1050658999 9:7862554-7862576 GTGGCTGGGGGGATGGTTTTGGG - Intronic
1052698182 9:31905864-31905886 GGGTCTGGTGGGATGGTGTTTGG + Intergenic
1056600410 9:88042602-88042624 CTGCCTGAGGGGAAGGTTTAGGG + Intergenic
1058400694 9:104615511-104615533 CTGTCGGGGGGTAGGGTGTTGGG + Intergenic
1058597576 9:106631327-106631349 CAGTATGGGGGGATGGTTTTGGG - Intergenic
1059611985 9:115908278-115908300 CTGTCTCAGGGGCTGGGGATAGG + Intergenic
1060089056 9:120727130-120727152 CTGTCTCTAGGCATGGTGTTGGG + Intergenic
1060459217 9:123833187-123833209 CTAATTGAGGGAATGGTGTTTGG + Intronic
1060876667 9:127088934-127088956 CTGGCTTAGTGGAAGGTGTTGGG + Exonic
1061905583 9:133694992-133695014 CTGGCTGAAGAGATGATGTTAGG + Intronic
1062159723 9:135073689-135073711 CTCTGTGAGGAGATGGTGCTGGG - Intergenic
1185785039 X:2883650-2883672 CAGGCTGGGGGGATGGTTTTGGG + Intergenic
1187237579 X:17482654-17482676 CAGTCAGTGGGGATGGAGTTGGG + Intronic
1188683567 X:33041958-33041980 CTATATGATGGGATGGGGTTGGG - Intronic
1191857960 X:65642934-65642956 CTCTCTGAGGGGATAGGGGTGGG - Intronic
1192068260 X:67909859-67909881 CTGTCTGAGGGAGAGGTGTGGGG + Intergenic
1194556406 X:95366113-95366135 CTGTCTGGGGTGATGGGGTTAGG + Intergenic
1195098869 X:101533489-101533511 CTGACTGAGGTGCTGGTGTGAGG + Intergenic
1196641611 X:118068907-118068929 CTGCCTGAGGGGATGGGGGAAGG - Intronic
1197196751 X:123710045-123710067 CTGTCTTAGGGGTTTGAGTTCGG - Intronic
1200268590 X:154660309-154660331 TTGTCTGTGAGGAAGGTGTTGGG + Intergenic