ID: 954878829

View in Genome Browser
Species Human (GRCh38)
Location 3:53820510-53820532
Sequence AGCACAGAAGCCCCTGCGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 208}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954878829_954878839 28 Left 954878829 3:53820510-53820532 CCTTCCGCAGGGGCTTCTGTGCT 0: 1
1: 0
2: 2
3: 18
4: 208
Right 954878839 3:53820561-53820583 CCTGCTGAATGTAGATCTCCAGG 0: 1
1: 0
2: 11
3: 128
4: 448
954878829_954878834 -6 Left 954878829 3:53820510-53820532 CCTTCCGCAGGGGCTTCTGTGCT 0: 1
1: 0
2: 2
3: 18
4: 208
Right 954878834 3:53820527-53820549 TGTGCTGAATGGAGGGTGATAGG 0: 1
1: 0
2: 1
3: 12
4: 202
954878829_954878835 -5 Left 954878829 3:53820510-53820532 CCTTCCGCAGGGGCTTCTGTGCT 0: 1
1: 0
2: 2
3: 18
4: 208
Right 954878835 3:53820528-53820550 GTGCTGAATGGAGGGTGATAGGG 0: 1
1: 1
2: 0
3: 18
4: 199
954878829_954878837 -1 Left 954878829 3:53820510-53820532 CCTTCCGCAGGGGCTTCTGTGCT 0: 1
1: 0
2: 2
3: 18
4: 208
Right 954878837 3:53820532-53820554 TGAATGGAGGGTGATAGGGCGGG 0: 1
1: 0
2: 0
3: 24
4: 284
954878829_954878836 -2 Left 954878829 3:53820510-53820532 CCTTCCGCAGGGGCTTCTGTGCT 0: 1
1: 0
2: 2
3: 18
4: 208
Right 954878836 3:53820531-53820553 CTGAATGGAGGGTGATAGGGCGG 0: 1
1: 0
2: 1
3: 13
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954878829 Original CRISPR AGCACAGAAGCCCCTGCGGA AGG (reversed) Exonic
901763970 1:11488340-11488362 AGCACAGAGGCCCTTGCTGTGGG - Intronic
901835450 1:11921200-11921222 AGCACAGAAGGCCGGGCGGCAGG + Intronic
905401582 1:37707471-37707493 AGCACACAGGCCCCAGCTGATGG - Intronic
907388261 1:54139766-54139788 CACAGAGAAGCCCCTGCGGGTGG + Exonic
908120736 1:60983811-60983833 AGAACAGACGCACCTGGGGAAGG - Intronic
912430119 1:109624502-109624524 ACCACAGAGGGCCCTGGGGAAGG - Intronic
912493882 1:110078824-110078846 TTCACAGAACCCCCTGCTGAAGG - Intergenic
913074979 1:115334516-115334538 AGCACTGAGGTCCCTGCCGATGG + Intronic
919134384 1:193489703-193489725 AGGACAGAAGCTCCTGCGTTTGG + Intergenic
922364650 1:224852276-224852298 AGCCCAGAAGCCCATGAAGAAGG + Intergenic
922471509 1:225879991-225880013 AGGAGAGAGGCCTCTGCGGAGGG + Intronic
922889268 1:229047740-229047762 AGCACAGAAGCCACTTCTGTAGG + Intergenic
923476475 1:234336653-234336675 AACACAGAAAACCCTGGGGAAGG + Intergenic
924801968 1:247334279-247334301 GGCACAGGAGCCCGTGGGGAAGG + Intergenic
1062794482 10:333465-333487 AGCTCAGAAGCACCTGCTGAGGG - Intronic
1065375789 10:25040054-25040076 AGGAGAGAGGCCCCTGAGGATGG - Intronic
1071806165 10:89123453-89123475 AGGACAGAACCCCCAGCAGATGG + Intergenic
1073082751 10:100870295-100870317 GGCTCAGAAGACCCTGGGGAGGG - Intergenic
1074761181 10:116668683-116668705 AGCCCAGAAGCCCCTGTGTTAGG + Intronic
1075341298 10:121648620-121648642 ACCACACAAGCCTCTGCGGCAGG + Intergenic
1075536574 10:123276672-123276694 AGCACAGATGCCTCAGGGGAAGG + Intergenic
1075768184 10:124911473-124911495 AGCACAGAGTCTCCTGCTGAGGG - Intergenic
1076631803 10:131856192-131856214 AGCACAGAAGCTGCAGCGGCAGG + Intergenic
1080908804 11:36574519-36574541 AGCTCAGAAGCACCGGCTGAGGG + Exonic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1083757654 11:64800307-64800329 AGCAGAGAAGCTCCTGCAGGTGG - Exonic
1083949791 11:65947604-65947626 AGCACAGGACTCCCTGCAGAAGG + Exonic
1084366958 11:68707994-68708016 GGCACAGCAGGCCCTGCGAAGGG - Exonic
1084425579 11:69082165-69082187 AGCACAGCAGCCCCGTAGGAAGG - Intronic
1084572436 11:69967768-69967790 TGCACAGAAGACTCTGCAGAGGG - Intergenic
1086193336 11:84107129-84107151 AGGAAAGAAGCCCCTGGGAAAGG + Intronic
1090459801 11:126880782-126880804 ACCAAAGAAGCCCCTGGGAAGGG + Intronic
1090976289 11:131683309-131683331 ATCACAGGAGCCCCTTCGGCAGG + Intronic
1091389576 12:117844-117866 AGGCCAGAAGCCCCTGCAGGAGG - Intronic
1092071374 12:5634147-5634169 AGCAGAGCTGCCCCTGAGGATGG + Intronic
1095725336 12:45446047-45446069 AGCACAGAAGCTGCAGCTGATGG + Intergenic
1096198980 12:49667633-49667655 ATCACAGAACCCTCTGAGGAAGG - Intronic
1098135333 12:67396035-67396057 AGCAAAGAAGCCCCACCAGAAGG - Intergenic
1104042031 12:125136800-125136822 CGCAGACAAGCCCATGCGGATGG - Exonic
1104960272 12:132485273-132485295 AGGTCTCAAGCCCCTGCGGAGGG + Intergenic
1105028171 12:132863561-132863583 AGCACAGATGCTCCAGTGGAGGG + Intronic
1105990485 13:25615502-25615524 AGCACAGAAGCCATGGCAGATGG - Intronic
1106791027 13:33154929-33154951 AGGAAAGAAGCCCCAGGGGAAGG - Intronic
1107016037 13:35708290-35708312 AGCTCAGGAGCCCCTGCGTGGGG + Intergenic
1108585510 13:51866746-51866768 AGCACTGACGCCCCTGATGAGGG + Intergenic
1108594129 13:51935811-51935833 TGCTCAGAAGCCCCTGCCAATGG + Intronic
1113549109 13:111177981-111178003 AACACAGAATTCCCTGCGCATGG - Intronic
1113673762 13:112194498-112194520 ACCAGTGAAGCCCCCGCGGAAGG + Intergenic
1116192307 14:41676377-41676399 AGCTCAGAAGCCACTGTTGAAGG + Intronic
1117656753 14:57963423-57963445 AGCCCAGCAGCCCCTGGGGCTGG + Intronic
1118696857 14:68394261-68394283 AGCCCAGCAGCCCCTGCAGATGG - Intronic
1119638184 14:76293533-76293555 AGCATAAAAGGCCCTGGGGATGG - Intergenic
1122891274 14:104733320-104733342 AGCCCTGAAGCCCCTTCGCAGGG - Intronic
1123804739 15:23859647-23859669 AGGACAGAAGCACAGGCGGAAGG - Intergenic
1123930539 15:25169448-25169470 GGCACAGAAGCCCATGAAGATGG - Intergenic
1124910497 15:33915706-33915728 AGCACAGAAGCCACAGCAGGTGG + Intronic
1127307985 15:57726981-57727003 AGATCAGAAGCCCCTGCGATTGG - Intronic
1128539899 15:68519086-68519108 TGCACAGGAGCCCTTGCGGGTGG + Intergenic
1128981852 15:72193996-72194018 AGGGCAGAAGCCCCTGGGAATGG - Intronic
1129169988 15:73801763-73801785 AACAGAGAAGCCGCTGTGGAGGG + Intergenic
1129234743 15:74217415-74217437 AGCAGAGAACCCCCTGCAGGTGG + Intergenic
1129468511 15:75737748-75737770 AGGACAGAAGCAGCTGGGGAAGG - Intergenic
1129727070 15:77906759-77906781 AGGACAGAAGCAGCTGGGGAAGG + Intergenic
1132995573 16:2820761-2820783 ATCACAGAAGGCCCCGGGGAGGG - Intronic
1134847107 16:17449335-17449357 AGAACAGCAGCCCCTGGAGAGGG + Intronic
1135929684 16:26726002-26726024 AGCACAGGAGCCCCAGCAGGTGG - Intergenic
1139531757 16:67545939-67545961 AGCACAGGAGGGCCTGTGGAAGG - Exonic
1141814810 16:86402372-86402394 AGCACTGAAGGCCCTGCAGGTGG - Intergenic
1141984648 16:87571923-87571945 AGCAGAGCAGCCCCAGCAGAGGG + Intergenic
1142218827 16:88842864-88842886 AGGCCAGAAGCACCTGCAGAAGG - Intronic
1143477156 17:7209207-7209229 AGCACAGGAGGCCCTTGGGATGG - Intronic
1144328801 17:14206423-14206445 AGCAAAGAAGCCCCTACACACGG - Intronic
1145795637 17:27653904-27653926 CGCACAGATGCCCCTGGGGCTGG + Intergenic
1147700205 17:42388766-42388788 GGCACAGAAGCCCGGGGGGAGGG + Intergenic
1148086703 17:44997953-44997975 AGCCCAGAGGCCCCTGCAGGGGG + Intergenic
1150083719 17:62263023-62263045 CGCACAGGAGCCCCGGCCGAGGG - Intergenic
1151666714 17:75549497-75549519 GACCCAGCAGCCCCTGCGGAGGG + Intronic
1151927802 17:77211577-77211599 AGAACAGAAGGCCCTGGAGAAGG - Intronic
1152677167 17:81647566-81647588 AGCTCAGCAGCCTCTGCGGAGGG + Intronic
1154297820 18:13165684-13165706 AGCACAGAAGCCGCGGCAGGCGG + Intergenic
1155867849 18:30988387-30988409 GGGACAGAAGCTCCTGGGGAGGG + Intergenic
1157728428 18:49983371-49983393 TGCTCAGAAGCCACTGCTGATGG - Intronic
1158955647 18:62535357-62535379 AGCACAGATGCCAGTGCTGAAGG + Intronic
1160015003 18:75133780-75133802 AGCACAGGGGCCCCGGGGGAAGG + Intergenic
1160717313 19:582215-582237 AGCACAGATGCCCCTGCTCGGGG + Intronic
1160779513 19:871698-871720 AGAACATAAGCCCCTGCAGGTGG - Intronic
1161580422 19:5077742-5077764 ACCCCTGCAGCCCCTGCGGAGGG - Intronic
1163304472 19:16469208-16469230 TGCACAGAAGCTCCAGGGGAGGG + Intronic
1163413645 19:17172528-17172550 AGCCCAGAAGCCCATGTGGGAGG + Intronic
1163730912 19:18948734-18948756 AGAGCAGAAGCCCGTGGGGAAGG + Intergenic
1165813957 19:38629795-38629817 AGCAGGGAAGCCCCTGTGGCTGG + Intronic
1166705709 19:44906759-44906781 AGCACAGAAGCCTCAGAAGAGGG - Intronic
1166810048 19:45509037-45509059 AGCAGGGAGGCCCCTGGGGACGG + Intronic
1167643954 19:50695804-50695826 ACCAGAGAAGCCCAGGCGGAGGG + Intronic
925020892 2:567028-567050 GGCACAGAAGCCCCTGAGAAAGG + Intergenic
926684554 2:15689109-15689131 AGCAGATAAGTCTCTGCGGAAGG - Intergenic
927720585 2:25379413-25379435 AGCAAGGAAGCCCCTGGGGTGGG - Intronic
928122278 2:28591794-28591816 AGCATAGCAGCCCCTGTGGAGGG - Intronic
929243611 2:39677865-39677887 AGCACAGAAGCCTCAGAAGATGG + Intronic
930855707 2:56015765-56015787 AGCCCAGAAGCGGCTGAGGAAGG + Intergenic
931501562 2:62874841-62874863 AGCAGACAGGCCCCTGCTGATGG + Intronic
932853324 2:75208994-75209016 AGCACAGAAGCCGCAGCAGGTGG - Intergenic
933566505 2:83957066-83957088 GGCACAGAAACCCCAGGGGAAGG + Intergenic
935174726 2:100639955-100639977 AGCACAGCAGCCCCAGCCCATGG + Intergenic
937257079 2:120563326-120563348 AGCCCAGAAGCCCCCGTGAAGGG + Intergenic
938266345 2:129930867-129930889 AGCCCAGAAGCCCCAGGGGACGG + Intergenic
948119161 2:235516038-235516060 AGCAGAGGAGCCCATGCGGCAGG - Intronic
1168797337 20:620355-620377 AGCACAGGAGCTGCTGGGGAAGG + Intergenic
1170122652 20:12927199-12927221 GGCACAGAAGTCCCTTCGGTTGG - Intergenic
1171379467 20:24723359-24723381 TGCACAGAAGTCCCTGCAGCAGG + Intergenic
1172227509 20:33314882-33314904 AGCTCAGAAGCCCAGGCGGGTGG - Intergenic
1172390618 20:34562551-34562573 ACCACAGAAGCCCATCTGGAAGG + Intronic
1172627968 20:36359477-36359499 GTCTCAGAAGCCCCTGCGGAAGG - Intronic
1174980102 20:55384452-55384474 ACCAGAGAACCCCCAGCGGAGGG - Intergenic
1175408439 20:58750621-58750643 GGCACAGAAGCCCCAGTGAAAGG + Intergenic
1175812079 20:61863844-61863866 GCCACAGAGGCTCCTGCGGATGG + Intronic
1180061698 21:45388628-45388650 AGCCCAGGAGCCCCTCAGGAAGG + Intergenic
1181329134 22:22075427-22075449 AGCACTGAAGCCACTGCTCAGGG - Intergenic
1183432052 22:37771838-37771860 AGCACAGGAGAGCCTGAGGAAGG - Intronic
1183432480 22:37774195-37774217 AGCTCAGAAGCCCAAGCAGAGGG - Exonic
1184041445 22:41946532-41946554 GGCACAGCACCCCCTGGGGAGGG + Intronic
951721466 3:25702985-25703007 AGCACAGAAGCCAATTAGGAAGG + Intergenic
951727347 3:25774757-25774779 AGCACAGAAGCCAAGGCAGACGG - Intronic
952522467 3:34175000-34175022 AGCACAGAAGCCACAGCAGGTGG - Intergenic
954878829 3:53820510-53820532 AGCACAGAAGCCCCTGCGGAAGG - Exonic
961346872 3:126268658-126268680 AGCAGGGCAGCCCCTGCAGAGGG + Intergenic
964380953 3:156098651-156098673 AGCACAGGAGTCCCTGAGGCTGG - Intronic
966657980 3:182381547-182381569 AGCCCAGAAGTCTCTGAGGATGG + Intergenic
968522664 4:1041087-1041109 AGCTCAGCTGCCCCTGTGGAGGG + Intergenic
968911602 4:3479326-3479348 TGAACAGGAGCCTCTGCGGATGG - Intronic
969542898 4:7804720-7804742 AGCACAGTAGCCTCTGGGGTGGG - Intronic
969589930 4:8115979-8116001 ACCACAGAAGTCCCCACGGATGG + Intronic
970391460 4:15616503-15616525 AGCACAGAAGCCATGGCAGATGG - Intronic
972612497 4:40668654-40668676 AGCACAGACCCCACTGGGGAAGG + Intergenic
972839918 4:42918521-42918543 AGCACAGGGGCACCTGTGGAGGG - Intronic
973024329 4:45248394-45248416 AGCAAAGAATACCCTGGGGAAGG - Intergenic
974289924 4:59916077-59916099 AGCACAGAAGGCACTGAGAAAGG + Intergenic
975690374 4:76957133-76957155 AGCACAGAAGGCCTTTCAGAAGG - Intronic
977009604 4:91620880-91620902 AGAAGAGTAGCCCCTGAGGATGG + Intergenic
977363861 4:96041620-96041642 AGCAGAGAATCCCCAGCTGAGGG + Intergenic
978840858 4:113209952-113209974 GGCACAGAAGCCCCTGGTAAGGG - Intronic
980403610 4:132326329-132326351 AGCACAGCAGCACCTGCAGTTGG - Intergenic
981064139 4:140463381-140463403 AGCACAGAAGCCACTGCCAAAGG + Intronic
981067223 4:140498075-140498097 AGCCCCGAAGCCCCCGCGGCGGG + Intronic
984710234 4:182878794-182878816 ACCACCGATGCCCCTGCAGATGG - Intergenic
985699754 5:1363441-1363463 ACCACAGCAGCCCCTGGGGAGGG - Intergenic
986645015 5:9908254-9908276 AGCACAGCAGCCTCTGCAGAGGG - Intergenic
986912347 5:12574021-12574043 AGCACAGAAGCCCATGGAGGGGG + Intergenic
986922162 5:12698919-12698941 AGCACAGCTGCCGCTGCAGACGG + Intergenic
987230900 5:15892464-15892486 AGCTCAGAAGTCACAGCGGAAGG + Intronic
988278596 5:29114650-29114672 AGCATAGAAGCCACAGCTGAAGG - Intergenic
988993044 5:36690141-36690163 AGCCCCGCAGCCCCTGCGGCGGG - Intergenic
989689290 5:44121092-44121114 AGAACATAAGGCCCTGTGGAGGG + Intergenic
990957630 5:61359459-61359481 AGCAGAGAAATCCCTGGGGAGGG + Intronic
997445182 5:133935183-133935205 AGGACAGAGGACCCTGAGGAAGG + Intergenic
1002480581 5:179498227-179498249 GGCCCAGATGCCCCTGCTGATGG - Intergenic
1002636126 5:180609650-180609672 AGCGCAGAAACCCCAGTGGAAGG - Intronic
1003578068 6:7315458-7315480 TGCACAGAAGCCCATGGGGTTGG - Intronic
1004085754 6:12447432-12447454 AGCACAGAAAATCCTGCAGAGGG - Intergenic
1007238504 6:40408361-40408383 AACCAAGAAGCCCCTGCCGAGGG - Intronic
1007325827 6:41058903-41058925 AGTCCAGAAGGCCCTGCTGAGGG + Intronic
1007608153 6:43131116-43131138 AGAACAGAAGTCCCTGCAGTAGG - Intronic
1007834899 6:44666754-44666776 GGCACAGAAGGGGCTGCGGACGG + Intergenic
1007941900 6:45789296-45789318 AGAGCAGAAGCCCCTGGGAAGGG - Intergenic
1008020761 6:46575108-46575130 ATCTCAGAAGCCCCTGGTGAAGG - Intronic
1008587491 6:52962710-52962732 AGCACAGGAGCCCATGGGGTGGG + Intergenic
1008604477 6:53127179-53127201 AAAACAGAAGCCCCTGTGCAAGG + Exonic
1010126685 6:72440638-72440660 AGCACAGAGGTCCTTGAGGAAGG - Intergenic
1010801932 6:80186546-80186568 AGCACAGAAGCCACAGCTGATGG - Intronic
1012869772 6:104659181-104659203 AGCACAGAAGCCACAGCCAAAGG + Intergenic
1013184349 6:107744992-107745014 GGCACTGCAGCCCCTGGGGAAGG + Exonic
1013422416 6:109978627-109978649 AGCCCAGAGACCCCTGCGAAGGG - Intronic
1013856617 6:114580982-114581004 AGCACAGAAGCCACAGCAGAAGG + Intergenic
1017979298 6:159385571-159385593 AGCCCAGAAGCAACTGCAGAGGG - Intergenic
1019095274 6:169574758-169574780 ACCACAGAAGCCACTGTGGAGGG + Intronic
1019538544 7:1541172-1541194 AGCGCAGAAGCCCCTGCCCACGG + Exonic
1019616316 7:1964226-1964248 AGTCAAGAAGCCCCTGCAGAAGG - Intronic
1019906232 7:4067269-4067291 GGCACAGAAGCTCCTGGGAAAGG + Intronic
1023259165 7:38341269-38341291 AGCACAGAAGGCAGTGGGGAAGG + Intergenic
1026035005 7:66824478-66824500 AGCACAGAAGCCACCGCTAATGG + Intergenic
1027796545 7:82700873-82700895 TGAAAAGAAGCCCCTGAGGATGG + Intergenic
1028028335 7:85875526-85875548 AGCACAGAAGCCACAGCCAATGG + Intergenic
1028531455 7:91842699-91842721 AGCTCTGAACCCCTTGCGGAAGG - Intronic
1032512723 7:132484745-132484767 AGCACAGAAAGCCCTGCAGATGG - Intronic
1035305500 7:157928892-157928914 AGCACAGAAGGCCAGGCAGAGGG + Intronic
1035386527 7:158476536-158476558 AGCACAGACGCCGCTCGGGAGGG + Intronic
1035454484 7:158998936-158998958 AGAAAACAAGCCCCTGAGGAGGG - Intergenic
1035477106 7:159151549-159151571 AGCACAGATGCCACTGCGGAGGG + Intergenic
1035781869 8:2233949-2233971 ACCACAGAAGACCCTGGGAAAGG + Intergenic
1035810250 8:2485457-2485479 ACCACAGAAGACCCTGGGAAAGG - Intergenic
1036077420 8:5516921-5516943 AGCTCAGCAGCCCCAGGGGAAGG - Intergenic
1036618091 8:10404249-10404271 AGCCCAGATGCCCCTGGGGAAGG - Intronic
1038584349 8:28775965-28775987 AGTACAGTGGCCCCTGTGGAAGG + Intronic
1038625641 8:29190457-29190479 AGGACAGAAGCTCCTGCGCTTGG + Intronic
1040819868 8:51544270-51544292 AACACAGAAGCTCCAGCAGATGG + Intronic
1040820084 8:51546657-51546679 AGCACAGAAGCTCCAGCGGATGG + Intronic
1042995464 8:74693462-74693484 AGCACAGAAGCCACAGCAGGTGG + Intronic
1044185035 8:89240542-89240564 AGCAAAGAAGCACCTGCTCAGGG + Intergenic
1046454479 8:114440575-114440597 AGCAGAGAAGCTCCTGGGAAAGG + Intergenic
1048899266 8:139022172-139022194 AGCCCAGAGGCTCCTGCAGAGGG - Intergenic
1049328724 8:142038523-142038545 AGGACAGAAGCCCCAGGGGCTGG - Intergenic
1049531611 8:143158219-143158241 AGCTCAGAAGCCCCGTGGGAAGG + Exonic
1049542320 8:143214245-143214267 AGCACAGAGGCCCCAGGGTAGGG + Intergenic
1049726596 8:144149237-144149259 AGCACTGAAGATCCTGCTGACGG - Intronic
1049769664 8:144374022-144374044 AGCCCAGCAGGCCCTGCGGGAGG - Intronic
1050024509 9:1320011-1320033 AGCAAAGAAGCCCCTTCAGCAGG - Intergenic
1055470203 9:76603195-76603217 AGAACAGAAATCCCTGCAGAGGG - Intergenic
1056080925 9:83093374-83093396 AGCACAGAAGCCCATGGAGGGGG + Intergenic
1056773188 9:89494459-89494481 AGCACGGAAGCCCATCTGGAAGG - Intronic
1057303483 9:93899663-93899685 GGCATAGAAGCCCCTGTGAAAGG - Intergenic
1060377304 9:123128213-123128235 AGCACAGCTGCCCCTGCCTATGG - Exonic
1061630101 9:131866943-131866965 AGGACAGAGGCCCGTGCTGAGGG - Intronic
1061968359 9:134029222-134029244 ACCACAGACTCCCCTGAGGACGG + Intergenic
1062117994 9:134819313-134819335 GGCACAGAGGCCCCGGCTGATGG + Intronic
1062218714 9:135403062-135403084 CACACAGAAGCCGCTGCAGAGGG + Intergenic
1062339720 9:136088597-136088619 GGCAGTGAAGCCCCTGCTGATGG - Intronic
1185758864 X:2673975-2673997 AGCACAGAAGCTCCTGACCATGG + Intergenic
1187794291 X:22985290-22985312 AGTTCTGAAGCCCCTGTGGAAGG + Intergenic
1188718954 X:33499833-33499855 AGCACAGAAGCCACAGATGATGG + Intergenic
1192713878 X:73618745-73618767 AGCACAGAAGCCACAGCAGGCGG - Intronic
1192905301 X:75544681-75544703 AGCACAGAAGCCTCAGCTGAAGG - Intergenic
1192924318 X:75739713-75739735 AGGACAGAAGCTGCTGAGGAGGG + Intergenic
1195706152 X:107739258-107739280 AGCTCAGAAGCTGCTGCTGAGGG + Intronic
1199134141 X:144231329-144231351 AGCACAGGAGCCCATGGAGAAGG + Intergenic
1200084026 X:153594164-153594186 ATCACAGCATCCCCTGGGGACGG + Intronic
1200235405 X:154465629-154465651 GGCACAGAAGGCACTGCTGACGG - Intronic
1201187179 Y:11415842-11415864 AGCAAAGAAGACCCTGAGGAAGG - Intergenic
1202368423 Y:24182201-24182223 AGGACAGAAGCAGCTGGGGAAGG - Intergenic
1202502362 Y:25487916-25487938 AGGACAGAAGCAGCTGGGGAAGG + Intergenic