ID: 954879048

View in Genome Browser
Species Human (GRCh38)
Location 3:53821618-53821640
Sequence TCTGGGGAGCAGTAAAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 326}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954879041_954879048 0 Left 954879041 3:53821595-53821617 CCTTTTGTTGAGCAGAGACAGCC 0: 1
1: 0
2: 0
3: 19
4: 153
Right 954879048 3:53821618-53821640 TCTGGGGAGCAGTAAAGAAGGGG 0: 1
1: 0
2: 2
3: 22
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954879048 Original CRISPR TCTGGGGAGCAGTAAAGAAG GGG Intronic
900626073 1:3609235-3609257 TCTGTGGAGCAGAAAGGAGGAGG - Intronic
901120428 1:6887673-6887695 TCATGGGCGCAGCAAAGAAGAGG + Intronic
901216460 1:7558142-7558164 TCTGGGAAGCAGGAGATAAGAGG - Intronic
901812437 1:11775656-11775678 ACTGGGGACCACTGAAGAAGGGG - Intronic
902689126 1:18098748-18098770 TCTGGGAAGCAGAAAGTAAGTGG + Intergenic
903774341 1:25783128-25783150 TTTGGGGAACAGTGAGGAAGTGG - Intronic
904036336 1:27561147-27561169 TCTGGGGAGCTGCAAAGGTGGGG - Intronic
904738404 1:32652470-32652492 TGTGGGGGGCAGTAGAGACGAGG - Intronic
904825749 1:33272705-33272727 CCAGGGGAGCAGTGAAGCAGAGG - Intronic
905417026 1:37810889-37810911 TATGGGGAGCAGTATGGAAATGG + Exonic
908306822 1:62827248-62827270 TCTGGAGGGAAGTAAACAAGGGG - Intronic
908743835 1:67356252-67356274 TCTGGGGAATAGTGATGAAGCGG + Intronic
910354825 1:86342179-86342201 TGTGGGGAGCAGAAAAGTGGAGG - Intergenic
911789390 1:101993125-101993147 TTTGGGGAACAGTTAAAAAGAGG - Intronic
912434340 1:109649490-109649512 TCTGCAGAGCAGAAAAGCAGGGG - Intergenic
914681364 1:149940742-149940764 GTTGGGGAGAAGGAAAGAAGGGG - Exonic
914912720 1:151800460-151800482 GGTGGGGAGCAGAAAAGAAAGGG + Exonic
914970221 1:152303193-152303215 TCTCGGGAGCAGTCAAGAGATGG - Exonic
914971478 1:152310972-152310994 TCTCGGGAGCAGTCAAGAGATGG - Exonic
915018967 1:152761662-152761684 GCTGGGGAGGAGGAGAGAAGTGG - Exonic
915304789 1:154970949-154970971 TCTGGGGAGAAGTAAAGTGGGGG + Intronic
916602384 1:166305839-166305861 TCTGAAGAGGAGCAAAGAAGTGG + Intergenic
917607916 1:176653929-176653951 TCTGAGAAACAGTAATGAAGAGG - Intronic
917651399 1:177081512-177081534 TCAGGAGAGCTGAAAAGAAGAGG + Intronic
919343064 1:196338311-196338333 TCAGGAGAGCAGCAAAGAGGTGG + Intronic
919702215 1:200642535-200642557 TCTGGGGTGCAGCAATGCAGTGG - Intronic
920314941 1:205070404-205070426 TCTGGGGACCAATACAGAATGGG - Exonic
920336985 1:205251431-205251453 TCTGGAGAACTGTAAGGAAGAGG - Intronic
920797820 1:209157783-209157805 TCTGGGGAGTAGAAATCAAGGGG - Intergenic
921276028 1:213520926-213520948 TCTGGGGAGTAGGAATGGAGAGG - Intergenic
922033720 1:221828152-221828174 TCTAGGGAGTAATAAAGAAGAGG - Intergenic
922182505 1:223246424-223246446 GCAGGGAAGCAGTAAAGCAGAGG + Intronic
922577950 1:226675505-226675527 TGTGGGGAGGAGGAAGGAAGGGG + Intronic
922625830 1:227041304-227041326 TCTGGGGACTACTAGAGAAGGGG - Intronic
922748644 1:228060657-228060679 GCTGGGCAGCTGCAAAGAAGGGG - Exonic
922784652 1:228276908-228276930 TCTGGGGAGGAGGAAGGAGGAGG - Exonic
924678692 1:246207897-246207919 CCTGGGGAGCAGTAAATTTGGGG + Intronic
1063719688 10:8567311-8567333 TCTCAGGAGCTCTAAAGAAGAGG - Intergenic
1064097074 10:12431730-12431752 TCAGGGAAGTAGAAAAGAAGAGG - Intronic
1064263876 10:13808884-13808906 TGTGGGGGGCAGTGATGAAGAGG - Intronic
1065919503 10:30379926-30379948 TCTGGGGAACACCAAAGATGAGG - Intergenic
1067488432 10:46674712-46674734 TGTGGGGAGCACAAAATAAGTGG - Intergenic
1067606237 10:47665668-47665690 TGTGGGGAGCACAAAATAAGTGG + Intergenic
1068294023 10:55043860-55043882 GAAGGGGAGCAGAAAAGAAGAGG + Intronic
1068654882 10:59564330-59564352 TCTGGGGAGCAGGAAAAGGGAGG - Intergenic
1069945529 10:71982936-71982958 TGTGGTGGGCAGTGAAGAAGGGG - Intronic
1070715725 10:78719667-78719689 TCTGGGGAAGAGAAAAGAAATGG + Intergenic
1070955906 10:80463389-80463411 TCAGGGGAGCAGAACTGAAGGGG - Intronic
1071296867 10:84227460-84227482 AGTGGGGGGCAGTAGAGAAGTGG - Intergenic
1071621795 10:87127015-87127037 TGTGGGGAGCACAAAATAAGTGG + Intronic
1073182856 10:101595990-101596012 TGTGTGGAGGAGTAGAGAAGTGG - Intronic
1073651072 10:105358875-105358897 TCTGGAGATCAGTAATTAAGGGG + Intergenic
1073931870 10:108585701-108585723 TATGGGAAGGAGAAAAGAAGAGG + Intergenic
1074736364 10:116438302-116438324 TTTAGGGAGCAGGAAAAAAGTGG + Intronic
1076093983 10:127715166-127715188 TCTGGGTAGCAGCAAGGAAGGGG + Intergenic
1076276562 10:129204376-129204398 TCTGGGGAGCAGAAGACCAGAGG + Intergenic
1077429591 11:2509545-2509567 TCTGGGAAGCAGGCAGGAAGTGG + Intronic
1078611220 11:12821121-12821143 TCTGGGCAGCAACAGAGAAGTGG - Intronic
1079485155 11:20928410-20928432 TCTGGGGAGCAATTGAGAGGGGG - Exonic
1080315296 11:30940376-30940398 ACTGGGGAGAGGTAAAGAAGAGG - Intronic
1081613173 11:44575610-44575632 TTTGGGTACCAGTAAAGTAGTGG + Intronic
1081742360 11:45449581-45449603 TGAAGGGAGCAGTAAAGAGGGGG - Intergenic
1081743770 11:45458898-45458920 TATGGCCAGCAGCAAAGAAGTGG - Intergenic
1082555276 11:54557040-54557062 TCTTGGGAGCAGTTTAGAAAGGG - Intergenic
1083078036 11:60061893-60061915 TCTGGGGAGCAGAAATGCAAAGG + Intronic
1083357887 11:62080820-62080842 TCTGGGGAGCAGGATAGAAGAGG + Intergenic
1084095398 11:66907954-66907976 TCCTGGGAGCGGTAAAGGAGGGG - Intronic
1084307762 11:68298007-68298029 TGTGGGGAGCAGTAATAACGAGG + Intergenic
1084686659 11:70700149-70700171 TGTGGGGAGCAGTGTGGAAGGGG - Intronic
1084728908 11:71060563-71060585 CCTGGGGAGCAGGAAGGCAGAGG + Intronic
1084954975 11:72686191-72686213 GCTGGGGAGCAGAGAGGAAGGGG + Exonic
1085898986 11:80674881-80674903 ACTGGGGATGAGAAAAGAAGTGG - Intergenic
1085973358 11:81621574-81621596 GCTGAGGAGGAGAAAAGAAGAGG - Intergenic
1086791314 11:91041912-91041934 TCTGAGGTGCAGTAAACAAATGG + Intergenic
1088979274 11:114847098-114847120 TAAGGGGAGCAGCAAAGGAGTGG - Intergenic
1089664350 11:120008524-120008546 TCTCTGCAGCAGTCAAGAAGGGG - Intergenic
1089735832 11:120549702-120549724 TCTGGGGTGCAGAGAAGGAGTGG + Intronic
1090832728 11:130430284-130430306 TCTGGGAAACAGCAAATAAGGGG - Intergenic
1091143587 11:133257993-133258015 TCTGGGGGTGAGTTAAGAAGCGG + Intronic
1091452441 12:581644-581666 TCTGGGGAGAAGGTAAGCAGGGG + Intronic
1092873919 12:12831992-12832014 TCTGGTGAGGAGTAAAGAGTAGG + Intergenic
1092967716 12:13660570-13660592 ACTGGGGATCAGAGAAGAAGAGG + Intronic
1093041925 12:14391040-14391062 TGTGAAGAGCAGTAAAGCAGGGG - Intronic
1094824690 12:34260765-34260787 CAGGGGGAGCAGGAAAGAAGGGG - Intergenic
1095418522 12:42001066-42001088 TCTTGGGAGGGGTGAAGAAGTGG - Intergenic
1095943217 12:47739620-47739642 TCTGGAGAGAAGCAGAGAAGAGG - Intronic
1098037619 12:66321341-66321363 TCTGGGGAGAAGGAAAGAGATGG + Intronic
1099934804 12:89112072-89112094 CCTAGGGAGGAGTAAAGAACTGG - Intergenic
1100076706 12:90793833-90793855 TTTGGGGAGCAGTAGACATGGGG - Intergenic
1100323911 12:93523272-93523294 TTTGGGTAGCAGGTAAGAAGAGG - Intergenic
1101432572 12:104638827-104638849 TCTAGGAAGCAGAAAAAAAGCGG - Intronic
1102595914 12:113992528-113992550 TCTCAGGAGCAGGAAAGATGTGG + Intergenic
1102968839 12:117149804-117149826 TGTTGGGAGGAGGAAAGAAGCGG + Intronic
1103173595 12:118843417-118843439 TCTGGGGTGGAGCAAAGTAGTGG + Intergenic
1103186442 12:118961768-118961790 TCTGGGGAGCTTAAAAAAAGAGG + Intergenic
1104208195 12:126661012-126661034 TCTGGGGAACTGTAATGCAGAGG - Intergenic
1110669095 13:78155077-78155099 ACTATGGAGCTGTAAAGAAGAGG - Intergenic
1111487962 13:88927933-88927955 TCTACAGAGCAGTAAAGAAAAGG - Intergenic
1112000830 13:95208280-95208302 GCTGGGGAGCAGAAAAGAAAGGG + Intronic
1112900252 13:104349884-104349906 TGTGGGTAGCAGGAAAGGAGAGG - Intergenic
1113058821 13:106299170-106299192 TATGGGGAGCAAGAAAGAGGGGG - Intergenic
1113569323 13:111342762-111342784 TCAGGAGAGCAGGAAAGAAAAGG + Exonic
1114875821 14:26716415-26716437 TATGGGGAGAAGGAAAGAAAAGG + Intergenic
1114980590 14:28158499-28158521 TCTGGGGTGGAGTAAAGTTGTGG - Intergenic
1115141579 14:30177547-30177569 ACTAGGGAGGAGTAAGGAAGGGG + Intronic
1116342300 14:43739387-43739409 TCTGGGACGGAGAAAAGAAGTGG - Intergenic
1117348508 14:54858033-54858055 TCTGGGGATCAATAAGAAAGTGG - Intronic
1117406361 14:55407989-55408011 ACTGTGGAGCAGTGAAAAAGAGG + Intronic
1117871456 14:60205208-60205230 TCTGGGGATCAGGAAGGGAGAGG + Intergenic
1118882781 14:69843102-69843124 TCTGGGGAGCAGGTCAGCAGTGG - Intergenic
1119465659 14:74856080-74856102 TCAAGGGAGAAGTCAAGAAGAGG + Intronic
1122006044 14:98704678-98704700 AGTGGGGAGCAGGAAGGAAGGGG - Intergenic
1122018768 14:98819497-98819519 TCTGAGGAGCTGTGAAGGAGTGG + Intergenic
1122564679 14:102644369-102644391 TCTTGGTAGGAGTACAGAAGTGG + Intronic
1124222305 15:27861387-27861409 TCTGGGGAGCAGCCCAGGAGAGG + Intronic
1124475036 15:30025815-30025837 TATGGGGAGAAGTAAAGATGGGG + Intergenic
1124871306 15:33545742-33545764 TCTGGGGAGCATGATAGAATAGG + Intronic
1125627599 15:41121493-41121515 TCAGGTGAGCAGGAAAGAAGTGG - Intergenic
1126628578 15:50710307-50710329 CCTGGGGATTAGGAAAGAAGAGG - Intronic
1128719040 15:69932552-69932574 ACTGGGGAGTAGTGAAGATGGGG + Intergenic
1128812590 15:70583588-70583610 TCTGGGGAGAGGCGAAGAAGGGG - Intergenic
1128999133 15:72318782-72318804 ACTGGGGAGGAGCAAAGAAGAGG + Intronic
1129269775 15:74413522-74413544 ACTGGGGAGCAGAAGAGGAGAGG - Intronic
1129768130 15:78182958-78182980 ACTTGGGAGCAGTAAAGGTGGGG + Intronic
1130749236 15:86692336-86692358 TCAGGGAAGCAATAAAGAAAAGG + Intronic
1131443047 15:92473154-92473176 TCTGAGGACCAGAAAAGAACAGG + Intronic
1131807772 15:96140782-96140804 TCTCGGTAGCAGTGAAGTAGAGG + Intergenic
1131946067 15:97623286-97623308 TAAGGGGAGCAGAAGAGAAGAGG + Intergenic
1132208185 15:100000811-100000833 TCTGGGGAGCAGTATGGTTGGGG - Intronic
1134040352 16:11063744-11063766 CATGGGGAGCATTAAAGATGTGG + Intronic
1135329610 16:21550297-21550319 ACTGGGGAGCAGTGAATGAGGGG - Intergenic
1136002068 16:27302412-27302434 CCCGGGGAGCGGTAAAGAATGGG + Intergenic
1136339947 16:29636252-29636274 ACTGGGGAGCAGTGAACGAGGGG - Intergenic
1138500420 16:57439326-57439348 TGTGGGCAGCTGAAAAGAAGAGG + Exonic
1139536211 16:67575865-67575887 TCTGTTGAGCAGTAGAGAAGTGG + Intronic
1139559633 16:67733986-67734008 TCTGGGGGGCTGTGAACAAGAGG + Intronic
1142042622 16:87904828-87904850 ACTGGGGAGCAGTGAACGAGGGG - Exonic
1142258184 16:89025787-89025809 TCTGGGGGGCTGTGAATAAGAGG + Intergenic
1145221638 17:21094249-21094271 TCTCAGGAGTGGTAAAGAAGTGG + Intergenic
1146258270 17:31404323-31404345 TCTGAGGTGCAGTAGAAAAGTGG - Intronic
1146793252 17:35764728-35764750 TCTGGGCAGCAGCTGAGAAGGGG - Exonic
1146943366 17:36858990-36859012 GCTGGGCAGCAGTCATGAAGTGG - Intergenic
1148744916 17:49912754-49912776 CCTGGAGAGCAGGGAAGAAGAGG - Intergenic
1151602539 17:75115089-75115111 CCTAGGGAGGAGGAAAGAAGGGG + Intronic
1152228266 17:79102564-79102586 CCTGGGGAGCAGGGAAGGAGGGG + Intronic
1152688493 17:81706883-81706905 CTTAGGGAGCAGGAAAGAAGGGG - Intronic
1157475224 18:48019733-48019755 TCTGGGGACCAGCAGAGAGGAGG - Intergenic
1158226300 18:55205099-55205121 TCTGGCCAGCAGAAAAGAGGAGG - Intergenic
1158516767 18:58137384-58137406 TCTGGAGGGCAGTGGAGAAGGGG + Intronic
1158526229 18:58216671-58216693 GCTGGGGAGCAGTGCAGAGGTGG + Intronic
1161993445 19:7698409-7698431 TCTGGGGAGGGGGAGAGAAGAGG + Exonic
1163495032 19:17641358-17641380 GCTGGGGTGCAGGAAACAAGAGG - Intronic
1164017790 19:21268159-21268181 GCTGGCTTGCAGTAAAGAAGCGG + Intronic
1164437821 19:28247358-28247380 TGAGGGGAGCAGTAAATGAGGGG - Intergenic
1165899226 19:39161047-39161069 TTTGGGGAACAGGAAGGAAGAGG + Intronic
1166348510 19:42182074-42182096 ACTGGGGAGAAGGAAAAAAGTGG + Intronic
1166707984 19:44919149-44919171 TGTGGGGAGGAATAAGGAAGGGG - Intronic
1166710036 19:44930976-44930998 TGTGGGGAGGAATAAGGAAGGGG - Intergenic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
1168047570 19:53805026-53805048 TCTCGGGAGAAAAAAAGAAGAGG + Intronic
925886483 2:8397615-8397637 TTTGGGAAGCCCTAAAGAAGAGG - Intergenic
926195263 2:10759936-10759958 TCTGGGAGCCAGTAAAGCAGTGG - Intronic
926517814 2:13871522-13871544 CCTGAGGAGCAGTAAAAAAAAGG + Intergenic
927412259 2:22840361-22840383 TCTGGGCAGCTGTGAAGAAAGGG + Intergenic
929235368 2:39599645-39599667 TCTGGGGCACAGAACAGAAGAGG + Intergenic
929618003 2:43327461-43327483 TGGGGGGAGAAGTAAAGAGGGGG + Intronic
931008268 2:57878082-57878104 TTTAGGGAGCAATAAAGAAAGGG + Intergenic
931257180 2:60583913-60583935 TTTGGGGAGCAGGAGAGCAGGGG + Intergenic
932405646 2:71511222-71511244 GCTGGGGGGCAGGAAGGAAGAGG + Intronic
933720218 2:85392887-85392909 TCTGGGGGGCACTAAACAGGTGG - Intergenic
933836344 2:86248968-86248990 TCTTGGGAGCACTACAAAAGAGG + Intronic
934571138 2:95374085-95374107 TGTGGGGGGCAGGAAAGCAGAGG + Intronic
934764743 2:96874367-96874389 TTTGGGGAGCAGTAGAGGAGGGG + Intergenic
938001547 2:127743952-127743974 TCTGGGGAGAGGTAAAGGATTGG + Intronic
938071620 2:128311449-128311471 TCTGGGGAGCAGTTACTGAGTGG - Intronic
938315539 2:130324736-130324758 TCTGCAGAGCAGAAAAGATGAGG + Intergenic
940763828 2:157768199-157768221 ACTGGGGAGCAGGGAAGGAGTGG - Intronic
941655737 2:168143260-168143282 GCTGTGGAGGAGCAAAGAAGTGG - Intronic
942727348 2:179025057-179025079 TGTAAGGAGCAGTAGAGAAGAGG - Intronic
945498419 2:210537822-210537844 ACTGGGGAGTAGTATGGAAGAGG - Intronic
946495522 2:220192147-220192169 TCTGGAGAGGAGCAAAGATGTGG + Intergenic
947635519 2:231679058-231679080 GCTGGGGAGCAGAACAGGAGAGG + Intergenic
947646112 2:231742060-231742082 TCTGGGGAGTAGAAAATAGGGGG + Intronic
1169059837 20:2653210-2653232 TCTGCGGCGCAGTCAAGCAGCGG - Intronic
1169871367 20:10251881-10251903 TCTGGGGAGATGGAAAGAACAGG + Intronic
1170044716 20:12072883-12072905 ACTGGGGAGCAGGGAAGGAGAGG - Intergenic
1170306515 20:14944640-14944662 TCTGGGAGGCAGAAGAGAAGTGG + Intronic
1170900513 20:20457908-20457930 TCTGGGGAGCAGTAGAGGCAGGG + Intronic
1172174944 20:32966559-32966581 GCTGGGGAGCAGGGAAGATGGGG + Intergenic
1172841859 20:37906781-37906803 TCAGGGAACCAGTAAAGCAGTGG + Intronic
1174744918 20:53052131-53052153 TCTGGGGAGTAGGAGAGAATGGG - Intronic
1175289804 20:57868170-57868192 TCTGGGGAGCAGGAGTGAGGGGG - Intergenic
1175861326 20:62151847-62151869 TCTGGGGAGCGGGAAAAGAGGGG - Intronic
1175861382 20:62152003-62152025 TCTGGGGAGCGGGAAAAGAGGGG - Intronic
1176071717 20:63230332-63230354 GCTGGGTTGCAGCAAAGAAGGGG + Intergenic
1176888949 21:14290996-14291018 GCTGGGGAGCAGAAAAACAGTGG - Intergenic
1178054736 21:28785466-28785488 TATAGGGAGAAGTAAAGAATTGG - Intergenic
1178599660 21:33984834-33984856 TTGGGGGAGCAGGAAGGAAGGGG + Intergenic
1178671780 21:34596954-34596976 GGAGGGGAGGAGTAAAGAAGGGG + Intronic
1178792473 21:35712987-35713009 TCTGGGGAGAAGTAGGGAGGAGG - Intronic
1178919304 21:36728307-36728329 TCTGGAGAACAGGAAAGAAGTGG + Intronic
1178938797 21:36887267-36887289 TCCGGGGTGCAGTAACAAAGTGG - Intronic
1178971790 21:37185155-37185177 TCAGGGTAGCATGAAAGAAGAGG + Intronic
1179666077 21:42913457-42913479 TCTGGGGAGAGGCAAAGATGGGG + Intergenic
1180592913 22:16956050-16956072 TGTGGGCAGCAGTACAGAATGGG - Intergenic
1180914711 22:19478153-19478175 GATCGGGAGCAGCAAAGAAGGGG - Intronic
1180980139 22:19874506-19874528 TCTGGGCAGCAGCCAGGAAGGGG - Intergenic
1182190329 22:28453428-28453450 TCTGGAGCTCAGTAGAGAAGTGG - Intronic
1182264421 22:29102519-29102541 TCTTGGGAGTGGTAAAGAGGGGG + Intronic
1182391962 22:30005440-30005462 GCTGGGAAGCATTGAAGAAGAGG + Intronic
1183623727 22:38989358-38989380 TATGGGGAGCAGGGAAGGAGTGG + Intronic
1183655266 22:39180749-39180771 GCTGGGGGCCAGAAAAGAAGGGG + Intergenic
1183832619 22:40426411-40426433 TCTGTGGAGAAGGAAAGCAGAGG - Intronic
950201623 3:11048487-11048509 CATGGGGAGCTGGAAAGAAGAGG - Intergenic
950920930 3:16693888-16693910 TCTGGGTAGCAGCAAACAACTGG + Intergenic
951677932 3:25263050-25263072 TCTAGGGATCAGCACAGAAGGGG + Intronic
952948226 3:38495849-38495871 GTGGGGGAGCGGTAAAGAAGGGG - Intergenic
954688473 3:52383364-52383386 TCTGGGGAGGGGTGAAGGAGTGG - Exonic
954879048 3:53821618-53821640 TCTGGGGAGCAGTAAAGAAGGGG + Intronic
955483675 3:59414504-59414526 TCTGGGGAAGGGTGAAGAAGGGG - Intergenic
956604160 3:71055032-71055054 TCAGGGGAGCAGTAAGCAAAAGG + Intronic
957870505 3:86085064-86085086 TCTGGGGTGGATTAAAGAGGAGG + Intergenic
959167242 3:102795702-102795724 TCTGGGTAGAAGCAAAGAACAGG + Intergenic
961739751 3:129025826-129025848 TCTGGAGAGCAGGACAGATGAGG - Intronic
962052862 3:131836108-131836130 TCTGGGTAGCAGTGCACAAGTGG + Intronic
962265377 3:133940708-133940730 GATGGGGAGCGGTAGAGAAGGGG + Intronic
962851806 3:139313710-139313732 TCTTGGGAGAAAGAAAGAAGAGG + Intronic
963259126 3:143176257-143176279 TGTGGGGAGAAGTAACCAAGCGG + Intergenic
965696610 3:171415041-171415063 ACTGGAGGGCAGTAAGGAAGGGG - Intronic
967767892 3:193302136-193302158 ACTGGGGAGTAGAAATGAAGTGG - Intronic
967899650 3:194436348-194436370 ACTGGGGATTAGGAAAGAAGTGG + Intronic
968708231 4:2093687-2093709 TCAGGGGTGCAGCACAGAAGAGG + Intronic
968884825 4:3322261-3322283 TCTGGGGAGGAGCAAGGAAGGGG + Intronic
969005948 4:4020164-4020186 TCTGGGGGGAAGTGAAGGAGAGG + Intergenic
969070621 4:4535474-4535496 CCTGGAGAGCATTAAAGCAGTGG + Intronic
969807001 4:9617126-9617148 TCTGGGGGGAAGTGAAGGAGAGG - Intergenic
971110557 4:23580619-23580641 GCTGGGTACCAGTAAATAAGGGG + Intergenic
971517768 4:27510114-27510136 TCAGGGAAGCATCAAAGAAGAGG - Intergenic
972376204 4:38473297-38473319 TCTGGGGATGGGGAAAGAAGTGG - Intergenic
977258148 4:94762986-94763008 TTTGAGGTGAAGTAAAGAAGTGG - Intronic
977278702 4:95011523-95011545 TCTAGGCAGCAGGAAAGAAGTGG + Intronic
978194118 4:105950764-105950786 GCAGGGGAGCAGGAAAGGAGGGG - Intronic
981311379 4:143301180-143301202 TCTGGGAAGAAGTAAAGATGAGG + Intergenic
981735218 4:147942633-147942655 TTAGGGGAGAAGGAAAGAAGGGG - Intronic
982242356 4:153313138-153313160 AGTGGGGAGCAGGAAAGGAGTGG - Intronic
982822332 4:159956950-159956972 TGTGGGGAACAGAACAGAAGTGG - Intergenic
983850957 4:172580635-172580657 TCTGGGGGGCTACAAAGAAGGGG - Intronic
984068950 4:175087129-175087151 TGTGGTGAGCAATTAAGAAGGGG + Intergenic
987057728 5:14210520-14210542 TCTGTGGAGCAGTTGAGAGGAGG + Intronic
987914820 5:24199137-24199159 TCAGGAGAGGAGTAAAGATGGGG + Intergenic
988082126 5:26427885-26427907 TCTGGGAAGTAATAATGAAGTGG - Intergenic
991957890 5:72014136-72014158 AGTGGGGAGCAGGAAAGAAAGGG + Intergenic
992121721 5:73600236-73600258 TCTGGGGGGCTTTGAAGAAGAGG - Intergenic
993077639 5:83254308-83254330 TATGGGCAGCAGAAAAGAAATGG - Intronic
995792899 5:115911778-115911800 TTGGGGGAGCAGGAAGGAAGGGG + Intronic
995821890 5:116244548-116244570 TCTGAGGAGGGGTAAAGAATAGG + Intronic
997509244 5:134442049-134442071 ACTGGGGAGCAGGGAAGAGGGGG + Intergenic
999267266 5:150275043-150275065 TCTGGGCAGCAGGAAATGAGCGG + Intronic
999507913 5:152217558-152217580 CCTAGGGAGAAGTAATGAAGAGG + Intergenic
999551843 5:152696095-152696117 TCTGGGGAACAGTAAAGAGTTGG - Intergenic
1000461330 5:161522647-161522669 TGTGGGGAGAAGAAAGGAAGGGG - Intronic
1000828498 5:166075110-166075132 TCTGGAGAACAGTAAACAGGAGG - Intergenic
1001208711 5:169789995-169790017 TCTGTGGAGCTGTAAATGAGAGG + Intronic
1001782589 5:174382857-174382879 CCTGGGGAGCAGAAAAGAGCTGG + Intergenic
1001846104 5:174922842-174922864 TCTGGGGAACACCAAAGATGAGG - Intergenic
1001903999 5:175455695-175455717 TCTGGGGCGAAGTTTAGAAGGGG + Intergenic
1002211416 5:177601723-177601745 TCTGAGGGGCAGTCCAGAAGAGG - Intronic
1002297874 5:178241408-178241430 TCTGGGAAGGAGGAAGGAAGGGG + Intronic
1006774118 6:36578529-36578551 TCTGGAGGGCACTAAGGAAGAGG + Intergenic
1006988522 6:38193393-38193415 TTTTGGAAGCAGGAAAGAAGGGG - Intronic
1007390019 6:41545712-41545734 TCTGCGAACCAGTGAAGAAGGGG - Intergenic
1008797353 6:55320554-55320576 TCTTGGGAGCAGTGGAGAACAGG - Intergenic
1008906164 6:56679897-56679919 TGTGGGTAGCAGGACAGAAGGGG - Intronic
1009291298 6:61886103-61886125 TCTAGGGTGGATTAAAGAAGAGG - Intronic
1010041657 6:71391760-71391782 TCTGGGAAGCAGTAATGTAGAGG - Intergenic
1011032297 6:82937028-82937050 TCTATGGAGCAGTAAAGAAAAGG - Intronic
1011169988 6:84494867-84494889 TCTGGGGAGAAGTTAGGAAGGGG - Intergenic
1011693771 6:89893654-89893676 TCAGGGTAGCAGTAAAGATTAGG - Intergenic
1012157191 6:95834113-95834135 ACTAGGGAGCAGTATAGAAAGGG + Intergenic
1012796629 6:103770366-103770388 ACTAAGGAGCAGTAAAGAAGAGG - Intergenic
1013191814 6:107810135-107810157 TCTTGGGAGCTGTGAAGAAGAGG + Intronic
1013428778 6:110037712-110037734 TCTGGGGAGGAGGGAAGGAGGGG + Intergenic
1014131156 6:117835518-117835540 TCTGGGGAGATGTAAAGAAGTGG + Intergenic
1014773683 6:125485015-125485037 TTTTGGGAGGTGTAAAGAAGTGG + Intergenic
1015126578 6:129761874-129761896 TCTGGGGACAGATAAAGAAGTGG + Intergenic
1017413967 6:154200292-154200314 TCTGGAGAGCATTGAAGAATAGG - Intronic
1017940067 6:159044912-159044934 TCCGGTGAGCTGTAAAGAATGGG + Exonic
1018767474 6:166945343-166945365 TCTGGGGAGGCGTGATGAAGAGG - Intronic
1020341023 7:7111124-7111146 TTTGGGGAACAAGAAAGAAGGGG - Intergenic
1022283491 7:28933562-28933584 GCCGGGGAGGAGTGAAGAAGGGG + Intergenic
1022529203 7:31056694-31056716 GCTGGGGAGCAGAGATGAAGGGG - Intronic
1022972554 7:35530918-35530940 GCTGGGGAGGAGTAAGGAGGAGG - Intergenic
1023270077 7:38453141-38453163 TCTGGGGAGGAGTCAGAAAGGGG - Intronic
1024145196 7:46508015-46508037 TCTGGGTAGCAGTAATTAACTGG + Intergenic
1024402078 7:48935941-48935963 TATGTGGAGCAGTAAAGGAAAGG + Intergenic
1029551890 7:101240906-101240928 TCTGGGGAGGGGCAGAGAAGAGG + Exonic
1029788364 7:102816420-102816442 TCTGAAGGGCAGGAAAGAAGTGG - Intronic
1030298974 7:107956488-107956510 TCTGGGGAGCAGTGAGTGAGGGG - Intronic
1031005409 7:116465055-116465077 TTTGTGAAGCAGTGAAGAAGAGG - Intronic
1031897241 7:127364657-127364679 GCTGGGGAGGGGTAAAGAGGAGG + Intronic
1031993122 7:128210766-128210788 GCTTGGGAGCAATAAAGCAGGGG - Intergenic
1033400127 7:141014994-141015016 TACGGGGAGCAGTAGAGAAACGG + Intronic
1036953438 8:13162765-13162787 GCTGGGGAGGCGTAAAGACGGGG - Intronic
1037184032 8:16040090-16040112 GGTGGGGAGAGGTAAAGAAGCGG - Intergenic
1038242369 8:25821781-25821803 GCTGGGGAGCAGAAAGAAAGAGG + Intergenic
1039662626 8:39483553-39483575 TCTGATGAGCAGTCCAGAAGAGG - Intergenic
1041091293 8:54303375-54303397 TCTGGAGAGCAGGAAAGGATTGG + Intergenic
1041560722 8:59215314-59215336 TCTGGGGAGGGGGAAATAAGTGG + Intergenic
1042754633 8:72197044-72197066 TCTGAGAAGCCCTAAAGAAGAGG - Intergenic
1043286384 8:78537065-78537087 TTTGGGGACCAGTTATGAAGGGG + Intronic
1044291120 8:90471783-90471805 TTTGGGGAGCAGGTGAGAAGAGG + Intergenic
1044510339 8:93070065-93070087 TCCGGGGAATAGTAAAGAATGGG - Intergenic
1045538333 8:103056808-103056830 TATAGGAGGCAGTAAAGAAGTGG + Intronic
1046201017 8:110927550-110927572 GCTGTGGAGCATGAAAGAAGAGG - Intergenic
1047182591 8:122603740-122603762 GAGGGGGAGCAGTAAGGAAGAGG + Intergenic
1047378160 8:124324788-124324810 TATGGGACACAGTAAAGAAGTGG - Intronic
1047435310 8:124831077-124831099 TCTGGGAGACAGAAAAGAAGTGG + Intergenic
1049878227 8:145041779-145041801 ATTAGGGAGCAGTAAGGAAGAGG - Intergenic
1050027607 9:1352012-1352034 TCTGGGGAGTGGTGAAGAATTGG - Intergenic
1050071374 9:1818175-1818197 CCTGGGGAGAAGGAATGAAGTGG + Intergenic
1050694035 9:8259697-8259719 TCTGGTGAGCAAGGAAGAAGAGG - Intergenic
1051314408 9:15812650-15812672 TATGGAGAGCAGTAGAGAACAGG + Intronic
1053696618 9:40645042-40645064 TATGGGGAGCAGTAAGGTTGTGG + Intergenic
1054307868 9:63444270-63444292 TATGGGGAGCAGTAAGGTTGTGG + Intergenic
1054406594 9:64768272-64768294 TATGGGGAGCAGTAAGGTTGTGG + Intergenic
1054440224 9:65253745-65253767 TATGGGGAGCAGTAAGGTTGTGG + Intergenic
1054490181 9:65768194-65768216 TATGGGGAGCAGTAAGGTTGTGG - Intergenic
1056061958 9:82892731-82892753 TCTGGAGAGCTGTTAAGGAGAGG + Intergenic
1056173874 9:84015125-84015147 CCTGGGGAGCAGAATAGGAGTGG - Intergenic
1056279230 9:85023729-85023751 TCTGTGACGCAGTAAGGAAGGGG + Exonic
1056776781 9:89518769-89518791 TCTGGGGAGGGGGAAGGAAGGGG + Intergenic
1056905928 9:90647852-90647874 TCTGGGGAGGAGGGAAGGAGAGG - Intergenic
1059067017 9:111096077-111096099 TCTGGGAACCAGTGCAGAAGAGG - Intergenic
1059854420 9:118380251-118380273 TCTGAGGAAAAGAAAAGAAGTGG + Intergenic
1060677222 9:125526221-125526243 TCTGTGGAGAGGTACAGAAGAGG - Intronic
1060893016 9:127200504-127200526 GCTGTGGAGCAGTGATGAAGAGG - Intronic
1202779068 9_KI270717v1_random:18702-18724 TATGGGGAGCAGTAAGGTTGTGG + Intergenic
1186813147 X:13209584-13209606 TGTGGGCAACAGTAAAGAAGGGG - Intergenic
1186920015 X:14268542-14268564 TTTGGGGAGCAGAAAAAATGAGG - Intergenic
1187262200 X:17696103-17696125 TCTGTGGTGCATTAAAGAAAAGG - Intronic
1187806583 X:23127759-23127781 GCTGGGGAACGGTAAATAAGGGG + Intergenic
1188623161 X:32251417-32251439 GCTGGAGAACAGAAAAGAAGGGG - Intronic
1188809761 X:34638911-34638933 CCAGGGGAGCAGTAAAAAAGGGG + Intronic
1188901708 X:35740711-35740733 TTTGGGCAGGAGAAAAGAAGGGG - Intergenic
1190320230 X:49175730-49175752 CCTGGGGAGCGATAAAGATGGGG + Exonic
1193144127 X:78059857-78059879 ATAGGGGAGAAGTAAAGAAGAGG + Intergenic
1194542348 X:95190114-95190136 TCATGAAAGCAGTAAAGAAGAGG - Intergenic
1194970265 X:100335279-100335301 TCTGGGCATCAGAAAAAAAGGGG + Intronic
1198416470 X:136425237-136425259 TCTGGGGAGAAGTATTGATGAGG + Intergenic
1200246200 X:154527370-154527392 TCTGCGAAGCAGAAAAGGAGAGG - Intergenic
1200273580 X:154711388-154711410 TCAGCAAAGCAGTAAAGAAGAGG + Intronic