ID: 954882022

View in Genome Browser
Species Human (GRCh38)
Location 3:53843017-53843039
Sequence CTGGAAAATTCCACCTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954882017_954882022 15 Left 954882017 3:53842979-53843001 CCAGCCAGGGCCTTGATTAATAT 0: 1
1: 0
2: 1
3: 8
4: 135
Right 954882022 3:53843017-53843039 CTGGAAAATTCCACCTGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 142
954882016_954882022 25 Left 954882016 3:53842969-53842991 CCACTGTTGACCAGCCAGGGCCT 0: 1
1: 0
2: 2
3: 14
4: 246
Right 954882022 3:53843017-53843039 CTGGAAAATTCCACCTGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 142
954882018_954882022 11 Left 954882018 3:53842983-53843005 CCAGGGCCTTGATTAATATTTGC 0: 1
1: 0
2: 1
3: 10
4: 119
Right 954882022 3:53843017-53843039 CTGGAAAATTCCACCTGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 142
954882019_954882022 5 Left 954882019 3:53842989-53843011 CCTTGATTAATATTTGCAAAAGA 0: 1
1: 0
2: 1
3: 32
4: 393
Right 954882022 3:53843017-53843039 CTGGAAAATTCCACCTGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954882022 Original CRISPR CTGGAAAATTCCACCTGTGT GGG Intronic
900807174 1:4775119-4775141 GTGGAAAATTCATCCTGTTTTGG - Intronic
905954994 1:41985259-41985281 CTGGAAAATTCTACATGTCCTGG - Intronic
906096069 1:43224811-43224833 TTGGAGAATTCCACCTGCCTTGG - Intronic
913659719 1:120995420-120995442 CTGGAAAAATCTTCCTGTATAGG + Intergenic
914011077 1:143778544-143778566 CTGGAAAAATCTTCCTGTATAGG + Intergenic
914166757 1:145182586-145182608 CTGGAAAAATCTTCCTGTATAGG - Intergenic
914649700 1:149687199-149687221 CTGGAAAAATCTTCCTGTATAGG + Intergenic
915923065 1:159992558-159992580 CTGGATAATTCCTCCTCTATGGG + Intergenic
917194188 1:172448897-172448919 ATGTAAAATTCCACAGGTGTAGG - Intronic
918414773 1:184295415-184295437 CTGGAATTTTCCACCTCAGTTGG - Intergenic
919521544 1:198595560-198595582 CCTGAAAACTCCAGCTGTGTTGG + Intergenic
920730347 1:208477536-208477558 CAGGAAAATACCACCTGGCTGGG - Intergenic
920909551 1:210202781-210202803 CTGGATAAGTCCACCTGCCTGGG - Intergenic
923370277 1:233304158-233304180 CTGTATAATTCCACCTCTATTGG - Intergenic
1069090382 10:64193339-64193361 CTGGAAAGTTCCAGGAGTGTAGG + Intergenic
1069185103 10:65412513-65412535 CTGGAAAATTCCCTCTGTCTTGG - Intergenic
1070964517 10:80521419-80521441 CTGGAAAGGCCCACCTGTGAAGG - Exonic
1073907194 10:108296011-108296033 TTGGACAAGTCCACCTGTGGTGG + Intergenic
1074235271 10:111578438-111578460 CTAGAACATTCCAGCTGGGTGGG + Intergenic
1074958074 10:118411974-118411996 CTTGAAAATTCCACTCCTGTTGG + Intergenic
1077361653 11:2143439-2143461 CGGGAAAGTTCCACTTGTTTTGG + Intronic
1078119108 11:8488309-8488331 CTGGAAAATTAGATCTCTGTAGG + Intronic
1078550923 11:12280160-12280182 ATGGAAAATTCTACCTGGGTGGG - Intronic
1080327325 11:31091698-31091720 CTGTAAAATGCCACCCTTGTTGG - Intronic
1080831347 11:35896105-35896127 CTGGAAAAGTCCCCATTTGTTGG + Intergenic
1084159870 11:67341646-67341668 CTCGCATAATCCACCTGTGTCGG - Intronic
1085390443 11:76179402-76179424 CTGGAAAAGCCCAGCTCTGTGGG - Intergenic
1085754844 11:79193816-79193838 CTAGAAAATGGCAACTGTGTTGG + Intronic
1088080949 11:105912893-105912915 CTAGCCAATTCCATCTGTGTTGG - Intronic
1092936946 12:13372907-13372929 CTGGAAAAATCAAAATGTGTAGG + Exonic
1094161163 12:27392512-27392534 CAGGAATATTCCTTCTGTGTGGG + Intronic
1098143938 12:67479467-67479489 CTGGAAAATTCAACATATGCAGG - Intergenic
1098799003 12:74929645-74929667 CTGGAAAATTCCACGTTTTGGGG + Intergenic
1102591574 12:113960165-113960187 TTGCAGAACTCCACCTGTGTGGG + Exonic
1104573003 12:129941855-129941877 CTGCAAAGTTTCACATGTGTGGG + Intergenic
1106782111 13:33069805-33069827 CTGCAAGATTCCAGCAGTGTTGG + Intergenic
1106926788 13:34621764-34621786 CTGGAATTTTTAACCTGTGTAGG - Intergenic
1108676776 13:52743880-52743902 CTGGAAAATTCCCCTTCTCTCGG - Intergenic
1109791646 13:67256217-67256239 CTAGAGTATACCACCTGTGTAGG - Intergenic
1110279082 13:73671751-73671773 CTGGAAAATGCCATATATGTAGG + Intergenic
1111843445 13:93478470-93478492 CTGGTAAATTATGCCTGTGTTGG - Intronic
1112256101 13:97832615-97832637 ATGGAAAAGTCCACCTGGGCTGG - Intergenic
1112278455 13:98042434-98042456 CTGGAAAATTGAACATCTGTAGG + Intergenic
1112870914 13:103969552-103969574 CAGGAAAATGCAACGTGTGTTGG + Intergenic
1115785003 14:36815652-36815674 CTGGAAACTTCCACATTTGGAGG - Intronic
1117287334 14:54299147-54299169 CTCAAAATTTTCACCTGTGTGGG + Intergenic
1117715262 14:58573776-58573798 CTGGTAAATTGCACCTGTACTGG + Intergenic
1121087888 14:91160450-91160472 CTGGGAATTACCAGCTGTGTAGG + Intronic
1121253763 14:92517096-92517118 CTGGAAGATTCCACCTGTCATGG + Intronic
1125192643 15:37011346-37011368 CTGGAAAATTTCAACTATCTTGG - Intronic
1125482878 15:40092754-40092776 CTGGGAAATGGTACCTGTGTGGG - Intronic
1133455412 16:5938181-5938203 CTGGAATATTCTACCTATCTTGG + Intergenic
1134649627 16:15898294-15898316 CTGGAAACTTCCTCCTGTTCTGG + Intergenic
1140460283 16:75134081-75134103 CTTAAAAATTCCACCTGGATTGG + Intergenic
1144597566 17:16583866-16583888 CTGGAAAATTCCCGCTGTAACGG + Intergenic
1145284912 17:21498133-21498155 ATGGGAATTTCCTCCTGTGTAGG + Intergenic
1146807483 17:35876533-35876555 CTTGCAAATTCCACCTTTGAAGG + Intronic
1148843876 17:50517252-50517274 AAGGAGAATTCCACCTGTGGTGG - Intronic
1159937362 18:74379955-74379977 CTGGAAATTTACAGATGTGTTGG + Intergenic
1161150166 19:2703261-2703283 CTGGTTCATTCCATCTGTGTTGG - Intergenic
1163195854 19:15719413-15719435 CTGGAAGATTGCTCATGTGTGGG + Intergenic
1164488920 19:28689155-28689177 CTGGGAACTTCCCACTGTGTTGG - Intergenic
1164625296 19:29723818-29723840 CTGCAAAATTCCAGCTGCATGGG + Intergenic
1167359240 19:49021052-49021074 TTGAAAAGTTCCACCTGGGTAGG + Intergenic
1167366936 19:49059295-49059317 TTGAAAACTTCCACCTGGGTAGG + Intronic
925502011 2:4515366-4515388 TTGGATAATTCCACCTATGCTGG + Intergenic
925582210 2:5422393-5422415 CAGGAAGCTTCCCCCTGTGTAGG - Intergenic
926298808 2:11587895-11587917 CTGGGCAATTCCACCTCTGAGGG + Intronic
930067647 2:47340050-47340072 CTTTAAAATTCCACCTGGTTGGG - Intergenic
930500297 2:52207971-52207993 CTGTAAAATTCCATCTCTATCGG - Intergenic
930980683 2:57523094-57523116 CTGGAAATTTGAACTTGTGTAGG + Intergenic
934945094 2:98535009-98535031 CTGGACAGCTCCACCTGGGTGGG - Intronic
936430507 2:112458471-112458493 CTGGAAAATTACACCACTCTTGG - Intergenic
937999890 2:127724564-127724586 CTGGTGAATTCCACATGTCTCGG + Intronic
939104991 2:137938449-137938471 AAGGAGAATTCCACTTGTGTAGG + Intergenic
939968185 2:148631375-148631397 CTGTATAATTCCACTTGTATGGG + Intergenic
939979808 2:148766578-148766600 CTGGAAAATTACTCTTTTGTAGG - Intronic
941173497 2:162168746-162168768 CTGGGAAATTCTACCTGAGGGGG + Intergenic
942531055 2:176911004-176911026 CTGGAAAGTCCCCCCAGTGTGGG + Intergenic
1170251399 20:14287857-14287879 CTGGAAAATGCCACATGTCAAGG - Intronic
1170341349 20:15330656-15330678 CAGGAAACTGCCACCTGTTTGGG + Intronic
1173321770 20:41993800-41993822 CTGGAAAATGCAGCCTGTATGGG + Intergenic
1176458441 21:6933293-6933315 AAGGAGAATTCCACTTGTGTAGG + Intergenic
1176836614 21:13798386-13798408 AAGGAGAATTCCACTTGTGTAGG + Intergenic
1177700282 21:24631137-24631159 CTGGAAAATTCCCTCTTTCTTGG + Intergenic
1180593019 22:16956628-16956650 CAGGAGAAGGCCACCTGTGTGGG - Intergenic
1181974212 22:26717257-26717279 CTGGAAAATTCCTCCCAGGTGGG - Intergenic
1184312591 22:43657441-43657463 CTAGAAAATCCCAACTGTTTTGG + Intronic
949729266 3:7089117-7089139 TTGGAAAATTCCAACTTTATTGG + Intronic
950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG + Intronic
952446355 3:33384675-33384697 CTGGAAGATTCAACTTGAGTTGG + Intronic
954882022 3:53843017-53843039 CTGGAAAATTCCACCTGTGTGGG + Intronic
956435067 3:69227043-69227065 GAGAAAAATACCACCTGTGTTGG + Intronic
961464129 3:127071254-127071276 CTGGAAAATTCCATCTGTACAGG + Intergenic
963218148 3:142774258-142774280 CTAGAAAATTACATATGTGTGGG - Intronic
966908748 3:184545959-184545981 CTAGAAAATTCCTCCTTTCTTGG - Intronic
974120776 4:57635536-57635558 AATAAAAATTCCACCTGTGTGGG - Intergenic
976688298 4:87840232-87840254 ATGGATAACTCCATCTGTGTTGG + Intronic
983526376 4:168764372-168764394 CTGGAAAACTCACCCTATGTTGG + Intronic
984858719 4:184218125-184218147 TTCTAAAATTCCACCTCTGTGGG - Intronic
988350994 5:30106812-30106834 CTGGAACAAGCCAACTGTGTTGG - Intergenic
989106442 5:37867474-37867496 ATGGAAAATTTCTTCTGTGTAGG + Intergenic
989632783 5:43503747-43503769 CACAAAAATTCCACCTGTGAAGG + Exonic
991195319 5:63925212-63925234 TTGGAAACTTCCACCTTTGAGGG - Intergenic
991678050 5:69108428-69108450 ATGGAAAATTCTACCTTTGCTGG - Exonic
992780063 5:80119643-80119665 CTGGAAAAGTCCTCCTCTCTGGG - Intronic
994767458 5:103936869-103936891 ACAGAAAATTCCACCTGTCTTGG + Intergenic
997079049 5:130716494-130716516 CTGAAAAATTACAACTGGGTGGG + Intergenic
997156114 5:131560026-131560048 CTGAAAAATTTCACCTATTTTGG + Intronic
998585329 5:143421108-143421130 CTGGAAACTTGCAACAGTGTGGG + Intronic
999231163 5:150062843-150062865 CTGGAAAATTCTTCCTCTGATGG - Intronic
999365712 5:151022119-151022141 CTGGAAAATGCCTTCTGAGTTGG - Intronic
1000078115 5:157814184-157814206 CTGGAAAATTACCACTTTGTAGG - Exonic
1001482321 5:172096707-172096729 CTGGAAAGTCCCAAGTGTGTTGG + Intronic
1001498761 5:172211670-172211692 GTGAAAAATTCCATCTGTGATGG - Exonic
1001833427 5:174808853-174808875 TTTGAAAACTCCAACTGTGTGGG - Intergenic
1002080252 5:176733367-176733389 CTGGGCCATTCCACCTGTGCTGG - Intergenic
1002884524 6:1281696-1281718 CTGGAACATCCCACTTGTGTAGG + Intergenic
1003338903 6:5201107-5201129 ATGGAAAACTCCAGCTGTGAAGG + Intronic
1004170241 6:13290192-13290214 CTGGAAAATGCAACCGGTCTGGG - Exonic
1009521181 6:64683805-64683827 GTGGAAAATTCCACTAGGGTTGG + Intronic
1010291724 6:74145446-74145468 CTGGAGTGCTCCACCTGTGTCGG + Intergenic
1012996653 6:105981734-105981756 CCGGAAAATTCAAGCTGTTTGGG + Intergenic
1016932419 6:149424394-149424416 GTGCAAACTTCCACCTGTGCTGG + Intergenic
1017926780 6:158917532-158917554 ATGGAATATTCCACCAGAGTGGG + Intergenic
1021121608 7:16801873-16801895 CTGGTATATTCCACCGTTGTGGG - Intronic
1027731901 7:81885028-81885050 CAGGAAATTACTACCTGTGTGGG + Intergenic
1028508715 7:91598097-91598119 CAGGACAATTGCACCTGTGTGGG - Intergenic
1036426354 8:8648487-8648509 TTGGAAAATTCCACCACTGGAGG - Intergenic
1037729985 8:21516180-21516202 CTGGGAAAGTCCAACTGTGGTGG + Intergenic
1038975027 8:32685841-32685863 CTGGAAGATTCCATTTCTGTGGG - Intronic
1039090039 8:33818161-33818183 CTGTAAAATTCCAGCAGTTTGGG - Intergenic
1042582081 8:70291096-70291118 CTTGAATATTCCACTTGTCTGGG - Intronic
1042945087 8:74146324-74146346 CTGGAGAATAGCACCTGTGGAGG + Intergenic
1048832622 8:138491449-138491471 CTGGAATATTGCAGCTATGTAGG + Intronic
1049355631 8:142186790-142186812 CTGCGACCTTCCACCTGTGTAGG + Intergenic
1050973232 9:11904711-11904733 ATGGTAAATGCCACCTGTATTGG - Intergenic
1058779613 9:108319640-108319662 CTGGAAAAGTCACCCTCTGTCGG - Intergenic
1060249736 9:121976176-121976198 TTGGAGAACTCCACCTGTGCAGG - Intronic
1185456609 X:313973-313995 CTGGAAGATTCCAACAGGGTGGG - Intronic
1185456629 X:314053-314075 CTGGAAGATTCCAACAGGGTGGG - Intronic
1185690519 X:2151466-2151488 CAGAAAAGATCCACCTGTGTGGG + Intergenic
1187193921 X:17063056-17063078 TTGGAGAATTCCCCCAGTGTTGG + Intronic
1188071900 X:25727526-25727548 CTGGCAAACTCCACCACTGTGGG - Intergenic
1194257472 X:91652471-91652493 CTGGCAAATTCCCCGTGTGCTGG - Intergenic
1194814195 X:98422898-98422920 ATGGAAATTTCCAGCTGTCTAGG + Intergenic
1196194865 X:112829037-112829059 CTGGAAACATCCATCTGTGGAGG - Intronic
1197427554 X:126316641-126316663 CTGGAAAATTCCATATATATAGG + Intergenic
1198523485 X:137475589-137475611 CTGCAACATTCCCCCTGTGATGG - Intergenic
1200576130 Y:4891417-4891439 CTGGCAAATTCCCCGTGTGCTGG - Intergenic