ID: 954882961

View in Genome Browser
Species Human (GRCh38)
Location 3:53847894-53847916
Sequence CATCAAAAGGAGATCTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 364}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954882957_954882961 -1 Left 954882957 3:53847872-53847894 CCCAAACTCAAATCATTCAAACC 0: 1
1: 0
2: 1
3: 21
4: 224
Right 954882961 3:53847894-53847916 CATCAAAAGGAGATCTTAGAAGG 0: 1
1: 0
2: 1
3: 28
4: 364
954882958_954882961 -2 Left 954882958 3:53847873-53847895 CCAAACTCAAATCATTCAAACCA 0: 1
1: 0
2: 0
3: 26
4: 256
Right 954882961 3:53847894-53847916 CATCAAAAGGAGATCTTAGAAGG 0: 1
1: 0
2: 1
3: 28
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954882961 Original CRISPR CATCAAAAGGAGATCTTAGA AGG Intronic
905604649 1:39286933-39286955 AATAAAAATGAGATCATAGAAGG - Intronic
906853691 1:49281729-49281751 CATCCAAAAGAAATCTTAAAAGG + Intronic
907029748 1:51158773-51158795 CAACAAAAGCAGTTCTAAGAGGG + Intergenic
907810839 1:57868211-57868233 CACCAAAAGGAAATGTCAGATGG - Intronic
908219227 1:61987001-61987023 CAGCTAAAGAAGAACTTAGAAGG - Intronic
909572376 1:77129986-77130008 CACCTAAAGGTGATTTTAGAAGG - Intronic
910347514 1:86257338-86257360 CATGAAAAGGAAAACTTAAATGG - Intergenic
911541082 1:99159404-99159426 CATCTAAAGCAGTGCTTAGAGGG - Intergenic
913032940 1:114930182-114930204 CAAATAAAGGAGCTCTTAGAGGG + Intronic
913162627 1:116158758-116158780 TATCTAAAGCAGTTCTTAGAGGG - Intergenic
913988838 1:143590383-143590405 GATAAAAAGGAAATCTTAAAAGG - Intergenic
914399054 1:147299115-147299137 CAGCAAAAGCAGTTCTTAGTGGG + Intergenic
918947422 1:191085610-191085632 CAGCAAAAGCAGGTCTAAGAGGG + Intergenic
919247804 1:195011630-195011652 GATCAATAGGAGATAGTAGATGG + Intergenic
919371301 1:196730233-196730255 CAGCAAAAGTAGTTCTAAGATGG - Intronic
919897396 1:202017934-202017956 CTTCTAAAGGAGATCCTAGCAGG + Intergenic
920042181 1:203107397-203107419 CAACTAAAGCAGTTCTTAGAAGG - Intronic
921874552 1:220179854-220179876 CAGCAAAAGGAGTGCTAAGAGGG + Intronic
923709384 1:236373807-236373829 CAGCAAAAGCAGTACTTAGAAGG - Intronic
924102235 1:240616684-240616706 CATCAAAAGGAGAAATCTGATGG - Intergenic
1062813968 10:485681-485703 CATTGAAAGAAGATTTTAGAAGG - Intronic
1063782839 10:9345911-9345933 CAGCAAAAGCAGTGCTTAGAGGG - Intergenic
1063912277 10:10843438-10843460 CAGCAAAAGCAGTGCTTAGAGGG - Intergenic
1064781965 10:18851268-18851290 CAACAAAAGCAGTCCTTAGAGGG - Intergenic
1065415771 10:25483791-25483813 CATCAAAAAGAAATTTTAAAAGG - Intronic
1067265597 10:44740741-44740763 CAGCAAAAGCAGTGCTTAGATGG + Intergenic
1068815889 10:61312326-61312348 CAGCAAAAGTAGTTCTAAGAGGG - Intergenic
1069049363 10:63776439-63776461 CTTCAAATGGAGATGTGAGAAGG - Intergenic
1069966556 10:72122886-72122908 CATCAAAAGCAGTGCTCAGAGGG + Intronic
1070316336 10:75316901-75316923 AAGCAAAAGCAGTTCTTAGAGGG + Intergenic
1070771241 10:79083576-79083598 CATCAGCCAGAGATCTTAGAGGG - Intronic
1071174692 10:82911885-82911907 CAACAAAAGCAGTTCTTAGAGGG - Intronic
1072902652 10:99422445-99422467 CATCAAAAATAAAGCTTAGAAGG - Intronic
1073557831 10:104470246-104470268 CATTTAAAGCAGAGCTTAGAGGG - Intergenic
1073639221 10:105232675-105232697 CAGCAAAAGCAGTACTTAGAAGG - Intronic
1073757979 10:106601517-106601539 CATCAAAAGGATGTCTTGGGAGG + Intronic
1075331123 10:121574726-121574748 CATCAAACAGAGACCTTATAAGG + Intronic
1077202220 11:1315852-1315874 CAGCAAAAGCAGAGCTAAGAGGG - Intergenic
1077448888 11:2622020-2622042 CAGCAAAAGCAGTTCTAAGAGGG - Intronic
1077561766 11:3267568-3267590 CAGCTAAAGCAGTTCTTAGAGGG - Intergenic
1077567660 11:3313388-3313410 CAGCTAAAGCAGTTCTTAGAGGG - Intergenic
1077759723 11:5080281-5080303 CAGCAAAAGCAGTTCTAAGAGGG + Intergenic
1077805936 11:5591076-5591098 CTTCAAAAGGAGAAATTAAAAGG + Intronic
1079844092 11:25442435-25442457 CAGAAAAAGGAGATAGTAGAGGG + Intergenic
1081177112 11:39942173-39942195 CAGCAAAAGCAGCTCTAAGAGGG - Intergenic
1081769286 11:45637676-45637698 CATTAAATAGAGTTCTTAGAAGG + Intergenic
1081839635 11:46188821-46188843 CAGCAAAAGCAGTACTTAGAGGG + Intergenic
1081860648 11:46331827-46331849 CATCAATAGGAGATATCAGATGG + Intergenic
1085589494 11:77745416-77745438 CAGCAAAAGCAAATCTAAGAGGG - Intronic
1086123029 11:83320039-83320061 CATCAAAGGGAAAACTTATAAGG - Intergenic
1088336555 11:108711168-108711190 CAACAAAAGCAGTACTTAGAGGG - Intronic
1088382595 11:109211808-109211830 CAGCAAAAGCAGTTCTCAGATGG + Intergenic
1089602967 11:119626503-119626525 CTTCAAAAGGAGATCAAAGCTGG - Intronic
1090168141 11:124573359-124573381 CAGCAAAAGCAGAGTTTAGAGGG + Intergenic
1090857120 11:130619892-130619914 CATCAAAAGCAGACTTGAGAGGG - Intergenic
1091660143 12:2377139-2377161 CAACAAAAGGAGAAATTAAATGG + Intronic
1092646693 12:10582155-10582177 CAATAAAAGGAGTTCTAAGAAGG + Intergenic
1093044115 12:14422030-14422052 CAACTAAAGCAGCTCTTAGAGGG + Intronic
1093061278 12:14608883-14608905 CAGCAAAAGCAGTTCTAAGAGGG - Intergenic
1093443307 12:19225622-19225644 CATTATAAGGTGATGTTAGAGGG + Intronic
1093506834 12:19876924-19876946 CAGCAAAAGCAGTGCTTAGAGGG - Intergenic
1093941661 12:25061606-25061628 CTTCAAAAGGAGTTCATTGAAGG + Intronic
1094210230 12:27882328-27882350 CAGCAAAAGTAGTTCTAAGAGGG - Intergenic
1094601025 12:31908998-31909020 CTGAAAAAGGAGATCTTAAATGG + Intergenic
1097146698 12:56945397-56945419 CAACAAAAGCAGAACTAAGAGGG - Intergenic
1097266157 12:57745962-57745984 CATCTAAGGAAGATGTTAGAAGG + Intronic
1098691380 12:73492495-73492517 CATCAAAAGCAGTTCTAAAAGGG + Intergenic
1099116779 12:78636495-78636517 CGTTATAAGGAGATCTCAGAAGG + Intergenic
1099159277 12:79220561-79220583 CAGCAAAAGCAGTTCTAAGAGGG - Intronic
1099485981 12:83229985-83230007 CAGCTAAAGGAGTTTTTAGAGGG - Intergenic
1099582887 12:84475525-84475547 CATCAAAAGCAGTGCTAAGAAGG + Intergenic
1100566725 12:95801869-95801891 CAGCAAAAGCAGTGCTTAGAGGG - Intergenic
1101459548 12:104876405-104876427 CAGCAAAAGCAGTTCTAAGAGGG - Intronic
1102491040 12:113289775-113289797 CCTCAAGAGCAGATCCTAGATGG + Intronic
1104154133 12:126114988-126115010 CATCAAGATGAGATCTTATCAGG - Intergenic
1105042975 12:132976171-132976193 CAGCAAAAGCAGTTCTAAGAGGG + Intergenic
1105976027 13:25473473-25473495 CAGGAAAAGGAGATCTTATTAGG - Intronic
1106979715 13:35263768-35263790 CAGCAAAAGGAGATCTCAGAGGG + Intronic
1107312043 13:39089761-39089783 CATCAAAAGGAGATGGAAAAGGG + Intergenic
1107859494 13:44647426-44647448 CAACAAAAGGAGATTTCAGAGGG + Intergenic
1107936704 13:45351529-45351551 CTTCAAAAGGAGATCCTGTAAGG - Intergenic
1108816440 13:54297652-54297674 CAGCAAAAGCAGATCTGAGAGGG - Intergenic
1110663186 13:78083056-78083078 CAGCAAAAACAGTTCTTAGAGGG - Intergenic
1110732762 13:78898681-78898703 CAGCAAAAGCAGAGCTTACAGGG + Intergenic
1111112298 13:83729703-83729725 CATCTAAAGGAGATCATTGCAGG + Intergenic
1111176635 13:84604742-84604764 CAGCAAAAGCAGACCTAAGAGGG - Intergenic
1111564553 13:89997751-89997773 GACCACAAGGAGATCTTACATGG - Intergenic
1112709088 13:102106070-102106092 CACAGAAAGGAGATCTAAGATGG + Intronic
1113344471 13:109462231-109462253 CACCAAAAGCAGGTCTAAGAGGG - Intergenic
1113353755 13:109556760-109556782 CAGCAAAAGCAGATCTAAGAGGG + Intergenic
1115131741 14:30061676-30061698 CAGCAAAAGAAGTTCTAAGAGGG - Intronic
1115782058 14:36780480-36780502 CAGCAAAAGCAGTTCTAAGAGGG - Intronic
1116062885 14:39946748-39946770 CAGCAAAAGCAGAACTAAGAGGG - Intergenic
1116338276 14:43687721-43687743 CATGAAAAGGAGAGATAAGAGGG - Intergenic
1117367404 14:55042828-55042850 CATGAAAAAGAGATGTTGGAAGG - Intronic
1118133759 14:62998604-62998626 CAGCAAAAGCAGTGCTTAGAGGG - Intronic
1121373878 14:93387388-93387410 CAGCAAAAGCAGAACTAAGAAGG - Intronic
1125055134 15:35350583-35350605 CAGCAAAAGCAGCTCTAAGAGGG - Intronic
1125060748 15:35420289-35420311 CAGCAAAAGCAGTTCTAAGAGGG + Intronic
1125246101 15:37642711-37642733 TATCAAAAGGAGATATCAAAAGG + Intergenic
1126609820 15:50517999-50518021 CAACAAAAGCAGTTCTAAGAGGG + Intronic
1126998241 15:54470892-54470914 CAGCAAAAGTAGTTCTGAGAGGG - Intronic
1127030933 15:54862096-54862118 CAACAAAAGCAGTTCTTATAGGG + Intergenic
1127215506 15:56819449-56819471 CATGTAAAGTAGATTTTAGAAGG - Intronic
1128332439 15:66764522-66764544 CATCAAAAGCAGATATAACATGG + Intronic
1130373464 15:83307031-83307053 TATCAAAAGGACATCTTGGAGGG - Intergenic
1131630420 15:94170507-94170529 CAGCAAAAGTAGACCTAAGAGGG - Intergenic
1131900071 15:97078198-97078220 CATCTAAAGGAAATATTATAGGG + Intergenic
1132159677 15:99527957-99527979 CAGCAAAAGCAGTTCTAAGAGGG - Intergenic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1134680965 16:16125194-16125216 CAGCTAAAGCAGTTCTTAGAGGG - Intronic
1135758057 16:25114519-25114541 CATCATAAGGAGAGCAGAGAAGG - Intronic
1136268379 16:29133817-29133839 CACCAACAGGAACTCTTAGAGGG + Intergenic
1137696384 16:50464844-50464866 CGGCCAAAGGAGATCTTGGATGG + Intergenic
1137971906 16:52994002-52994024 AATCAGATGTAGATCTTAGATGG + Intergenic
1138755774 16:59482914-59482936 CATCAAAAGCAGTTCTAAGAGGG - Intergenic
1139868072 16:70079574-70079596 CTTAAAAAGGAGTTCATAGATGG + Intergenic
1140340145 16:74150228-74150250 CAGCTAAAGCAGAACTTAGAGGG - Intergenic
1140387266 16:74552279-74552301 CTTAAAAAGGAGTTCATAGATGG - Intronic
1141819878 16:86437972-86437994 CATTAAAAGGAGACCTTGGCTGG + Intergenic
1142071690 16:88094154-88094176 CACCAACAGGAACTCTTAGAGGG + Intronic
1142727548 17:1827633-1827655 CATCAAAAAGAGATGTTACCAGG + Intronic
1143721383 17:8812745-8812767 CATCAAAAGCAGTGCTAAGAGGG + Intronic
1144048556 17:11476428-11476450 CAGCAAAAGCAGTACTTAGAGGG - Intronic
1145228858 17:21155952-21155974 CAGCAAAAGCAGTGCTTAGAGGG + Intronic
1145399481 17:22519647-22519669 CATCATATGGAGATGTTGGATGG - Intergenic
1146091710 17:29885837-29885859 GAGCAAAAGGACATCTTACATGG - Intronic
1146582716 17:34053293-34053315 CAGCACAGGGAGCTCTTAGAGGG - Intronic
1147223772 17:38958399-38958421 CCATAAAAGGATATCTTAGAAGG - Intronic
1152500971 17:80708775-80708797 CATGAAAAGCAGTTCTTGGAGGG + Intronic
1153549229 18:6243396-6243418 CATCAAAATGAAGTCTTAGACGG + Exonic
1155430496 18:25751122-25751144 CAACAAAAGCAATTCTTAGAAGG + Intergenic
1155579520 18:27287256-27287278 CATCAAAAGATGTTCTGAGATGG - Intergenic
1155762735 18:29587978-29588000 CAGCAAAAGCAGCTCTAAGAGGG + Intergenic
1155933658 18:31732096-31732118 CAGCAAAAGCAGTTCTAAGAAGG + Intergenic
1156183212 18:34630217-34630239 TATGAAAAGGAGAGCTTATAGGG + Intronic
1156645179 18:39152455-39152477 CATCAAAACAAAAACTTAGATGG + Intergenic
1157365104 18:47057701-47057723 CATCAAAAGGGGATTGCAGAAGG - Intronic
1157879642 18:51308301-51308323 CAGCAAAAGCAGTTCTAAGAGGG + Intergenic
1158322004 18:56273762-56273784 GAACAAAAGGACATCTTACATGG - Intergenic
1158430453 18:57380801-57380823 AATCAAAAGGAAATGCTAGAAGG + Intergenic
1159397359 18:67878975-67878997 CAGCAAAAGCAGTTCTGAGAAGG - Intergenic
1159571412 18:70117975-70117997 CAGCAAAAGCAGGTCTAAGAAGG + Intronic
1160473213 18:79158149-79158171 CAGCAAAAGCAGTACTTAGATGG - Intronic
1160536084 18:79593310-79593332 CAACAAAAGCAGTACTTAGAGGG + Intergenic
1166245976 19:41526128-41526150 CAGCAAAAGCAGAACTAAGAAGG + Intergenic
925354794 2:3232451-3232473 CAGCAAAAGCAGGTCTAAGAAGG - Intronic
925523079 2:4769480-4769502 CAGCAAAAGCAGTGCTTAGAGGG - Intergenic
926494258 2:13564747-13564769 CAGCAAAAGTGGATCTAAGAGGG + Intergenic
926960160 2:18348599-18348621 CAGCTAAAGCAGTTCTTAGAGGG - Intronic
927080810 2:19628730-19628752 CAGCAAAAGGAGCACTAAGAAGG + Intergenic
928061130 2:28114474-28114496 CTTCAATAGGAGATCCTACAAGG - Intronic
928346651 2:30503937-30503959 CATTAGAAGGGGATCTTAGAAGG - Intronic
928841890 2:35617745-35617767 CATCAAAAGCAGTTCCAAGAGGG - Intergenic
929364945 2:41142804-41142826 CATCAAAAGCAGCCCTCAGAGGG - Intergenic
929638654 2:43552461-43552483 AATCAAAAAGAGATCTTTCAGGG + Intronic
931528854 2:63189908-63189930 CAGTAAATGGAGTTCTTAGATGG + Intronic
931982251 2:67706586-67706608 CATTTAAAGGTGATCTTATAAGG - Intergenic
933105571 2:78320794-78320816 AATCAAAAACAGATTTTAGAAGG + Intergenic
933121599 2:78544716-78544738 TATCAAAAGCAGTGCTTAGAAGG - Intergenic
934016085 2:87884288-87884310 CAGCAAAAGTAGTTCTAAGAAGG + Intergenic
934996905 2:98971535-98971557 CAGCAAAAGTAGCTCTAAGAGGG - Intergenic
935257954 2:101329140-101329162 CTGCAGAAGGAGATATTAGAAGG + Intergenic
935621225 2:105131433-105131455 GATCAAAAGGAGATATGATAGGG + Intergenic
935703352 2:105833802-105833824 CATCAAAAGCAGTGCTAAGAGGG - Intronic
935928439 2:108095758-108095780 CATCAGAAGCAGAGCTCAGAGGG + Intergenic
939745630 2:145962853-145962875 TATTAAAAGGATATATTAGATGG + Intergenic
940406913 2:153314765-153314787 CAACAAAAGCAGTGCTTAGAGGG + Intergenic
940655332 2:156480947-156480969 CATTAAAAAGAGACCTTAGGAGG - Intronic
940773687 2:157864974-157864996 CATTAAAAGCAGAGCTTATATGG - Intronic
941256486 2:163238271-163238293 CAGCAATAGCAGATCTAAGAGGG - Intergenic
942473115 2:176283269-176283291 CAACAAAATTAGATCCTAGAGGG + Intronic
942554744 2:177160191-177160213 CATCAAAGGGAGATCATGGTGGG + Intergenic
942951677 2:181728834-181728856 CTTCATGAGGGGATCTTAGAGGG + Intergenic
943905524 2:193495645-193495667 GATCAAAAGAAAATCTTAGAAGG + Intergenic
944448661 2:199818813-199818835 CATCAAAATGTGACCTTACATGG + Exonic
945463737 2:210142616-210142638 CAGCAAAAGGAGTTCTAATAAGG - Intronic
946753254 2:222915170-222915192 CTTCAAAAGGAGCTCTGTGAGGG - Intronic
946975526 2:225144995-225145017 CAACAAAAGCAGTTCTAAGAGGG + Intergenic
947453276 2:230228057-230228079 CAACAAAAGCAGCACTTAGAAGG - Intronic
947600620 2:231447083-231447105 CAGCTAAAGCAGTTCTTAGATGG - Intergenic
947705598 2:232273070-232273092 CTTCAAAAGGTGAACCTAGAAGG - Intronic
948267996 2:236651603-236651625 CATCAAAAGCAGTGATTAGAGGG - Intergenic
1168775606 20:444930-444952 CAGCAAAAGGAGAGCTCTGAAGG + Intronic
1168988473 20:2072522-2072544 CAGCAAAAGCAGTACTTAGAGGG + Intergenic
1170191114 20:13646326-13646348 CATCAAAAGGTGGTCTTGGCCGG - Intergenic
1171398347 20:24855119-24855141 TATCCAAAGAAGTTCTTAGAGGG + Intergenic
1173673469 20:44813868-44813890 CAACATAAGGAGATCGAAGAAGG + Intergenic
1174956345 20:55102965-55102987 CAGCAAAAGCAGTTCTAAGAGGG + Intergenic
1176900012 21:14429154-14429176 CAGCAAAAGCAGTTCTGAGAGGG + Intergenic
1177247209 21:18543368-18543390 GATAAACTGGAGATCTTAGAGGG - Intergenic
1178017265 21:28363414-28363436 CAGCAAAAGCAGTTCTAAGAAGG - Intergenic
1178017474 21:28365942-28365964 TATAAAATGGGGATCTTAGAAGG - Intergenic
1178256528 21:31057600-31057622 CAGCAAAAGCACATCTTACATGG + Intergenic
1178362484 21:31960630-31960652 GAGCAAAGGGACATCTTAGATGG + Intronic
1178668378 21:34568547-34568569 CAGCAGAATGAGCTCTTAGAGGG + Intronic
1179144986 21:38760226-38760248 CATCAAATGGAGGTCTGAGTTGG + Intergenic
1179196484 21:39168705-39168727 CAACAAAAGGAGCTCTAGGAGGG - Intergenic
1179528363 21:41999670-41999692 CATCAAAATGGGATCAAAGAAGG + Intronic
1180124065 21:45775985-45776007 CAGCAAAAGCAGAGCTAAGAGGG - Intronic
1181421270 22:22800710-22800732 CCTCAAAATGGGATCTTATATGG - Intronic
1182970848 22:34575085-34575107 CCTCAAAAGCAGTTCTTGGAGGG - Intergenic
1183154766 22:36066422-36066444 CATGTAAGGGAGATCTTACAGGG - Intergenic
1184028513 22:41876483-41876505 CATCAGAAGAAAATCTTAAATGG + Intronic
1184888394 22:47363359-47363381 CAACAAAAGCAGTGCTTAGAAGG - Intergenic
949687712 3:6596447-6596469 CATCAAAATCAGATCTAAAAGGG - Intergenic
951446448 3:22786509-22786531 CAGCAAAAGCAGTGCTTAGATGG + Intergenic
951568138 3:24033393-24033415 CAGCAAAAGCAGTTCTAAGAGGG - Intergenic
951616488 3:24552001-24552023 CTTCATAAGGAGATCTTTGTTGG + Intergenic
952439271 3:33308743-33308765 CAGCAAAAGCAGTTCTGAGAGGG - Intronic
953893149 3:46770766-46770788 CAGCAAAAGCAGTTCTAAGAGGG + Intronic
954591291 3:51785462-51785484 CATCAAAAGCAGTGCTCAGAAGG - Intergenic
954882961 3:53847894-53847916 CATCAAAAGGAGATCTTAGAAGG + Intronic
955470922 3:59285218-59285240 CATCCAAAGTAGATAATAGAAGG + Intergenic
957253523 3:77806647-77806669 CATCAAACTGGGATCTGAGAAGG - Intergenic
957888820 3:86327991-86328013 CATAAAAAGGATATCTCAGAAGG - Intergenic
958840235 3:99194806-99194828 TAGCAAAAGCAGATCTAAGATGG + Intergenic
960633706 3:119760865-119760887 CAACAAAAGCAGTTCTAAGAGGG + Intronic
961237728 3:125382090-125382112 GATGATAAGAAGATCTTAGATGG + Intergenic
962237680 3:133721239-133721261 CAGCAAAAGCAGTTCTAAGAGGG - Intergenic
962910188 3:139841278-139841300 CATCAACAGTGAATCTTAGATGG - Intergenic
963052886 3:141157700-141157722 CATAAGAAGGAGCTCTTAGGGGG + Intergenic
964435602 3:156648927-156648949 CAGCAAAAGCAGTGCTTAGAGGG + Intergenic
964733778 3:159894930-159894952 CATCAAAAGGTTTTCTGAGAAGG - Intronic
965006299 3:163030254-163030276 CATGAAACGCAGATATTAGAGGG + Intergenic
966481349 3:180412514-180412536 CATCAAAAAAAGATTTTAAAGGG + Intergenic
966719617 3:183049083-183049105 CATCAAAAGCAGTGCTTAGTGGG + Intronic
967800815 3:193657400-193657422 CAGCAACAGGTGATTTTAGAAGG - Intronic
969155098 4:5203240-5203262 CATCAAAAGAAAATCTAAAAAGG - Intronic
969212870 4:5701189-5701211 GATCAGAAGGAGATGTTTGAAGG - Intronic
969250454 4:5964831-5964853 CATTAAAATTAGATCATAGAAGG + Intronic
970684600 4:18552241-18552263 CAGCAAAAGAAGTTCTAAGAGGG - Intergenic
971530127 4:27677035-27677057 CAGCAAAAGTAGTTCTAAGAGGG - Intergenic
971804897 4:31343850-31343872 CAGCAAAAGCAGTTCTTAGAGGG + Intergenic
971884035 4:32420048-32420070 CAGCAAAAGCAGTTCTAAGAGGG - Intergenic
972166110 4:36286309-36286331 CACCTAAAGGAGGTGTTAGAGGG - Intronic
972189974 4:36578826-36578848 CAACAAAAGGAGTTCTAACAGGG + Intergenic
972278107 4:37577697-37577719 CAGCAAAAGCAGTACTTAGAGGG - Intronic
972898512 4:43654333-43654355 CATGAAAACGAGAATTTAGAGGG + Intergenic
972929879 4:44059050-44059072 CATAAAAAGGCTATCCTAGAAGG - Intergenic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
973882042 4:55282532-55282554 CAGCAAAAGCAGTTCTAAGAGGG - Intergenic
974893949 4:67915581-67915603 CATCAAAAGGAGATTATCAAAGG + Intronic
976021025 4:80626373-80626395 CAGCAAAAGCAGTTCTAAGAAGG + Intronic
977474605 4:97489765-97489787 CTTCAGAAGGAGACCTTTGAAGG - Intronic
978033405 4:103965226-103965248 CATCAAAAGAAGTACTTAGAAGG - Intergenic
978141045 4:105317738-105317760 CATTCTAAGGAGATCTTAGAAGG - Intergenic
978404669 4:108366578-108366600 CATCCTAAAGAGAGCTTAGATGG + Intergenic
978495122 4:109350934-109350956 AATAAGAAGCAGATCTTAGAGGG - Intergenic
978722939 4:111934822-111934844 GAGCAAAAGGAAATCTTACATGG - Intergenic
978814722 4:112890925-112890947 AATGAAAAGGAGTTCTTAGAAGG - Intronic
980256177 4:130383031-130383053 GAGCAAAAGGACATCTTACATGG - Intergenic
980488546 4:133493376-133493398 CATCAAAGGGTGATATTTGATGG - Intergenic
981195937 4:141920644-141920666 AATCAAAAGGAGAGTTTAGAAGG - Intergenic
982293694 4:153805550-153805572 CATCAAATGAAAATCTGAGAAGG - Intergenic
983299312 4:165904870-165904892 CATCAAAAAGAGAAATTGGACGG + Intronic
983658759 4:170110676-170110698 CATGAAAAGGAGGTGGTAGAGGG - Intergenic
983982151 4:174011199-174011221 AATCAAAATGAGATCATATATGG + Intergenic
984343837 4:178494122-178494144 CAGCAAAAGCAGTTCTAAGAGGG + Intergenic
985076549 4:186221438-186221460 CAGCAAAAGCAGTTCTAAGAAGG - Intronic
987152141 5:15053691-15053713 CATCAAAAGAAGTACTAAGAAGG - Intergenic
988820215 5:34876126-34876148 CAGCAAAAGTAGTGCTTAGAGGG + Intronic
990004142 5:50924777-50924799 CAGCAAAAGCAGATCTAAGAAGG + Intergenic
990041231 5:51381061-51381083 CATTAAAAGGAGACGTTTGAGGG - Intergenic
990238292 5:53791369-53791391 AAACAAAAGGAAAACTTAGAAGG + Intergenic
990448136 5:55911984-55912006 TATCAAAAAGAGTTCCTAGAGGG - Intronic
991339233 5:65587937-65587959 CATCCACTGGAGGTCTTAGAAGG + Intergenic
993899710 5:93576715-93576737 CATCAGAAGTAGATCTGAGTTGG - Intergenic
993983447 5:94569609-94569631 CATCATGTGGAGATGTTAGATGG - Intronic
994287278 5:97984492-97984514 CATCCACTGGAGATCTTAGAAGG + Intergenic
994509126 5:100681504-100681526 CAGCAAAAGCAGTTCTAAGAGGG - Intergenic
995432154 5:112092063-112092085 CAGCAAAAGGAGTACTAAGAGGG + Intergenic
995639642 5:114239792-114239814 CATCAAATGAAGATCTCAGGAGG - Intergenic
996321651 5:122223299-122223321 CAGCAAAAGCAGTTCTCAGAGGG + Intergenic
997054976 5:130431428-130431450 CAGCAAAAGGAAATCTTAAAAGG + Intergenic
997168710 5:131691332-131691354 CAGCAAAAGGAGTGCTTAAAGGG + Intronic
999469899 5:151844792-151844814 CTTCAAAAGAATATCTAAGATGG + Intronic
1001469548 5:172001146-172001168 ATTCAAAAGGAAATCTTAAAAGG + Intronic
1002857940 6:1054935-1054957 CATCAAAAGGTGATCTAAGTGGG + Intergenic
1003851530 6:10228019-10228041 AATGGAAAAGAGATCTTAGAAGG + Intergenic
1005878568 6:30035324-30035346 CATCACAATGAAATTTTAGAAGG - Intergenic
1009789398 6:68382049-68382071 CAGCAAAAGCAGAACTAAGAGGG - Intergenic
1009993046 6:70867158-70867180 CATCTAAAGGAGTGTTTAGATGG + Intronic
1010000189 6:70940985-70941007 CATCTAAAGGACATTTTAGATGG - Intronic
1010497012 6:76546434-76546456 CATCAAAAGCAGTGCTTAGAGGG - Intergenic
1011567535 6:88692979-88693001 CAGCAAAAGCAGTTCTAAGAGGG + Intronic
1011943968 6:92878302-92878324 CAGCAAAAGCAGTTCTTAGAGGG - Intergenic
1011969836 6:93209484-93209506 TTTCAAAAGGAGATCATGGAAGG - Intergenic
1012332283 6:98008011-98008033 CAGCAAAAGCAGTGCTTAGAGGG - Intergenic
1013441192 6:110171418-110171440 CATCAAAAGCAGTGCTTGGAGGG + Intronic
1013776182 6:113680872-113680894 CAGCAAAAGCAGTTCTAAGATGG + Intergenic
1014207214 6:118669275-118669297 CCTCAAAAGCAGATCTGAGTTGG - Intronic
1014327336 6:120015629-120015651 CAGCAAAAGGAGTTCTTTTAAGG + Intergenic
1014390838 6:120861355-120861377 CATCAAAAGTAGTCCTAAGAGGG + Intergenic
1014528980 6:122537004-122537026 CAACAGATGGAGATCTTATATGG - Intronic
1014722411 6:124933734-124933756 TAGTAAAAGGAGATCTTAAAAGG + Intergenic
1015302130 6:131665866-131665888 CAGCAAAAGCAGCTCTAAGATGG - Intronic
1015504422 6:133967380-133967402 AATCAATAAGAAATCTTAGAAGG + Intronic
1016801623 6:148174609-148174631 CAAAAAAAAGAAATCTTAGAAGG - Intergenic
1016983419 6:149875123-149875145 CAGCAAAAGCAGTTCTAAGAAGG - Intergenic
1017733036 6:157335009-157335031 CAACAAAAGAAGATCTTATTTGG - Intergenic
1020580725 7:9996803-9996825 CATCAAAAGCAGTCCTAAGAAGG + Intergenic
1020781434 7:12520386-12520408 CAGCAAAAGCAGTTCTAAGAAGG - Intergenic
1020807673 7:12810512-12810534 CATCATAATCAAATCTTAGAAGG + Intergenic
1021547759 7:21834340-21834362 CAGCAAAAGCAGTTCTAAGAGGG + Intronic
1022852107 7:34274315-34274337 CATCCACTGGAGATCTTAAAGGG + Intergenic
1022899433 7:34789140-34789162 CAACAAAAGCAGGTCTAAGAGGG + Intronic
1024107083 7:46101688-46101710 CATCTAAAGTAGAGCTTAAAGGG + Intergenic
1024503510 7:50140345-50140367 CATCAAAATCAAACCTTAGATGG - Intronic
1024621833 7:51165956-51165978 CAGCAAAAGGAGTACTAAGAGGG + Intronic
1025226899 7:57173428-57173450 CATCATATAGAGATATTAGATGG - Intergenic
1025229966 7:57196709-57196731 CATCATATAGAGATATTAGATGG - Intergenic
1026535214 7:71233443-71233465 CAACAGAAGTAGACCTTAGAAGG + Intronic
1027520925 7:79206068-79206090 CAGCAAAAGCAGATATGAGAGGG + Intronic
1027577760 7:79952060-79952082 GAGCAGAAGGAGATTTTAGAGGG + Intergenic
1028024767 7:85822686-85822708 CAGCAAAAGCAGTTCTAAGACGG - Intergenic
1028105504 7:86872305-86872327 CAGCAAAAGCAGTTCTAAGAGGG + Intergenic
1028407937 7:90496837-90496859 CAGCAAAAGTAATTCTTAGAGGG - Intronic
1028626042 7:92878517-92878539 CAACAAAAGCAGTTCTAAGAAGG + Intergenic
1030231918 7:107216741-107216763 CAGCAAAAGCAGTTCTAAGAAGG + Intronic
1030312313 7:108081168-108081190 CAGCTAAAGGAGATCTGGGAGGG - Intronic
1030707190 7:112705558-112705580 CAGCAAAAGCAGTGCTTAGAGGG + Intergenic
1031167196 7:118243547-118243569 CATTAAAAGTAGAGCTTACAAGG - Intergenic
1031222288 7:118984135-118984157 CATCAAAAGCAGTACTTAGAGGG + Intergenic
1031615344 7:123872996-123873018 CATCAAAAGGAGAGCTGTTAGGG + Intronic
1031957312 7:127955591-127955613 CAGCAAAAGGAGAGCTTATTAGG - Intronic
1032771507 7:135063523-135063545 CAGCAAAAGCAGTTCTAAGAGGG - Intronic
1033412873 7:141135723-141135745 CAGCAAAAGCAGTTCTAAGAGGG + Intronic
1035149585 7:156857938-156857960 CAGCAAAAGCAGCGCTTAGAGGG + Intronic
1035928181 8:3752315-3752337 CATCAGAAGGCAATCTAAGATGG + Intronic
1039291888 8:36104935-36104957 CATCTAAAGGAGTATTTAGAGGG + Intergenic
1039336266 8:36593464-36593486 GAACAAAAGGAGATCTAATAAGG - Intergenic
1040627671 8:49169618-49169640 CATCAAAAGCAGTACTTAGAAGG - Intergenic
1040847960 8:51864705-51864727 CATCAAAAGCAGTTCTAAAAGGG + Intronic
1042387184 8:68190313-68190335 CATCAAAAATAGATACTAGATGG + Intronic
1043075513 8:75693891-75693913 CATTAAAATGAGCTCTCAGATGG - Intergenic
1044915165 8:97105708-97105730 CTTCAAAATAAGATTTTAGAAGG + Intronic
1046686745 8:117236286-117236308 CAGCAAAAGGTGATCAGAGAAGG - Intergenic
1046837369 8:118817510-118817532 CCTGAAAAGGAGATCTGAGTTGG - Intergenic
1047230093 8:122990508-122990530 CATTACAGGGACATCTTAGATGG + Intergenic
1048920053 8:139220017-139220039 CAGCAAAAGAAGTACTTAGAAGG + Intergenic
1051073338 9:13200565-13200587 CAGCAAAAGCAGTTCTGAGAGGG - Intronic
1051722725 9:20055060-20055082 CAAAAAAAGGAGATATTTGAGGG + Intergenic
1051816626 9:21115293-21115315 CAGCAAAAGCAGTTCTAAGAGGG + Intergenic
1051962628 9:22786894-22786916 CAGCTAAAGGAGTGCTTAGAGGG - Intergenic
1051964146 9:22805233-22805255 CAACAAAAGCAGTTCTGAGATGG + Intergenic
1051990791 9:23150242-23150264 CAGCAAAAGGAGCACTAAGAGGG - Intergenic
1052200343 9:25770814-25770836 CAGCAAAAGCAGTTCTAAGAGGG + Intergenic
1053488141 9:38477560-38477582 CAGCAAAAGCAGTTCTAAGAGGG + Intergenic
1054833692 9:69653796-69653818 CAGCAAAAGCAGTTCTAAGAGGG + Intronic
1055761236 9:79610620-79610642 AAACAAAAGGAGATCTTTAACGG + Intronic
1055906357 9:81298410-81298432 CAGCAAAAGCAGTGCTTAGAGGG + Intergenic
1055908827 9:81324551-81324573 CAGCAAAAGCAGTTCTAAGAGGG - Intergenic
1056996290 9:91463337-91463359 CAGCAAAAGTAGAAGTTAGAAGG - Intergenic
1057668501 9:97066833-97066855 CAGCAAAAGCAGTTCTAAGAGGG + Intergenic
1058103593 9:100944701-100944723 CATCAAAAGCAGTTCTAAGAGGG - Intergenic
1058865373 9:109157020-109157042 AATCTAAAAGAGAGCTTAGAGGG - Intronic
1059520355 9:114934938-114934960 CATCAAAAGATAATCTTAAATGG - Intergenic
1059924159 9:119190163-119190185 CATCAAAAGAAGTTATCAGAGGG + Intronic
1060097670 9:120806714-120806736 CATCAAAAGCAGTTCTAAAAGGG - Intergenic
1185746785 X:2579748-2579770 CATGTAAAGGAGATTTTAGGAGG + Intergenic
1186013963 X:5169581-5169603 CATCATATAGAGATATTAGATGG - Intergenic
1188274540 X:28183272-28183294 CAGCAAAAGGAGAACTTCCATGG - Intergenic
1189022872 X:37360296-37360318 CAGCAAAAGTAGTGCTTAGAGGG - Intronic
1189059703 X:37739087-37739109 GATCAAAAGCAAGTCTTAGAGGG - Intronic
1189313347 X:40035418-40035440 CATCAAAAGTAGGTCATAAAAGG + Intergenic
1190518073 X:51245449-51245471 TATCAAAAGCAGTTCTAAGAGGG + Intergenic
1190569067 X:51763544-51763566 CATCAAAGAAAGATCCTAGAAGG + Intergenic
1190911972 X:54780511-54780533 CAGCAAAAGCAGTTCTCAGAGGG + Intronic
1191576873 X:62715734-62715756 CATCAGAAGGAGGACTCAGAAGG + Intergenic
1192540560 X:71967437-71967459 CAGCAAAAGCAGTGCTTAGAAGG - Intergenic
1192663433 X:73066682-73066704 CAGCTAAAGCAGTTCTTAGAGGG + Intergenic
1192771270 X:74194930-74194952 CAGCAAAAGCAGTTCTAAGAGGG - Intergenic
1193632467 X:83907273-83907295 AACCAAAAGGAGATTTTATAGGG - Intergenic
1194136816 X:90154538-90154560 CAGCAAAAGCAGAACTAAGAGGG + Intergenic
1194220646 X:91185157-91185179 CATCAAAAGCAGCTCTATGAGGG + Intergenic
1194333650 X:92616772-92616794 AATAAAAAGGAAATCTTAGATGG - Intronic
1194514764 X:94838962-94838984 CAGCAAAAGCAGTTCTAAGAAGG - Intergenic
1194927539 X:99843691-99843713 CAGCAAAAGCAGTTCTAAGAGGG + Intergenic
1194975468 X:100392055-100392077 CCTCAAGAGGAGATCATGGAAGG - Intronic
1195486384 X:105412147-105412169 CAACAAAAGCAGTTCTAAGAGGG + Intronic
1196083701 X:111660975-111660997 AATGAGAAGGAGCTCTTAGAAGG + Intergenic
1196155737 X:112427702-112427724 CAGCAAAAGCAGTTCTTAAAGGG - Intergenic
1196333627 X:114502930-114502952 CAGCAAAAGCAGAGCTAAGAGGG + Intergenic
1199032603 X:143017907-143017929 CAGCAAAAGGAGTTCTCATATGG + Intergenic
1199128403 X:144154254-144154276 CAGCAAAAGTAGTTCTAAGAAGG - Intergenic
1199149433 X:144412792-144412814 CAGCAAAAGCAGCTCTAAGAGGG - Intergenic
1199221723 X:145323963-145323985 CAGTAAAAGTATATCTTAGAAGG - Intergenic
1199333999 X:146597372-146597394 CATCAAAAGCAGTACTAAGAGGG - Intergenic
1199435878 X:147812072-147812094 CATCATATTGAGAACTTAGAAGG - Intergenic
1200482562 Y:3724495-3724517 CAGCAAAAGCAGAACTAAGAGGG + Intergenic
1200557155 Y:4648909-4648931 CATCAAAAGCAGCTCTATGAGGG + Intergenic
1200642332 Y:5735776-5735798 AATAAAAAGGAAATCTTAGATGG - Intronic
1200897437 Y:8390615-8390637 TATCAGAAGGAGATCCTGGATGG + Intergenic