ID: 954883188

View in Genome Browser
Species Human (GRCh38)
Location 3:53849649-53849671
Sequence TCCCAGGGCCATCTCCAGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954883188 Original CRISPR TCCCAGGGCCATCTCCAGAG TGG Exonic
900243817 1:1628809-1628831 TCCCTGGGCCATCACTGGAGGGG - Intronic
900631345 1:3637454-3637476 ACCCAGGGCTATCTCCAGCTAGG + Intronic
900871272 1:5305331-5305353 TCCCATGGCCAAGTCCAGTGTGG - Intergenic
900929687 1:5728835-5728857 TCACAAGGCCTTCTCCAGGGAGG - Intergenic
901414871 1:9109723-9109745 TCCCACAGCCATCTCCAGCAAGG + Intronic
902519374 1:17007358-17007380 TGCCAGGGCCCTCCCCAGACTGG + Intronic
902575859 1:17377083-17377105 TCCCACCTCAATCTCCAGAGTGG + Intronic
902697718 1:18151478-18151500 TTCAAGGGCCAGGTCCAGAGTGG + Intronic
904396503 1:30225855-30225877 TCCCAGGCCTGTCTCTAGAGGGG + Intergenic
904970005 1:34412100-34412122 TCACAGGACCAGCTCCAGAAGGG + Intergenic
905741364 1:40374006-40374028 GCCCAGGGGCACCTCCTGAGCGG - Exonic
905927880 1:41764875-41764897 AGCCAGAGCCATCTCCTGAGAGG + Intronic
906688098 1:47775403-47775425 GCCCAGCGCCCTCTCCTGAGGGG - Exonic
906689986 1:47786129-47786151 TCTCAGGCTCATCTGCAGAGTGG + Intronic
907283809 1:53367823-53367845 CCCCAGGGCTATCTCCCCAGGGG + Intergenic
907409548 1:54274661-54274683 GGCCATGGCCACCTCCAGAGGGG + Intronic
911268902 1:95776664-95776686 TCCCTGGGTCTTCTTCAGAGTGG - Intergenic
912719584 1:112008448-112008470 TCCCAGGGAAATCTAAAGAGAGG + Intergenic
913079637 1:115370620-115370642 TCCCACGGCCATCTCCATCATGG - Intergenic
913086912 1:115447380-115447402 TCCCATGCCTGTCTCCAGAGTGG + Intergenic
914892409 1:151637927-151637949 TCCCATGGCTATCCCAAGAGAGG - Intronic
915006713 1:152645071-152645093 GCCCAGGGCAGTTTCCAGAGTGG + Intergenic
916733258 1:167584813-167584835 GCTGAGGGCAATCTCCAGAGAGG + Intergenic
916984773 1:170179324-170179346 TCCAAGGCCAATGTCCAGAGTGG + Intergenic
919997562 1:202767348-202767370 TCCCAGGGCCCTCCTCACAGTGG + Intronic
920570478 1:207012953-207012975 TTCAAGGGACATTTCCAGAGGGG + Intronic
922096415 1:222446669-222446691 TCCCAATGCCATCTCCAGCCTGG + Intergenic
922703923 1:227779031-227779053 TCCCTGTGCCATCTGCAGAGGGG + Intronic
923669639 1:236029511-236029533 TCCCAGGGCCAGCCCCAGACCGG - Intronic
1063383659 10:5602360-5602382 TCCCAGGCACATCTGAAGAGGGG + Intergenic
1064618923 10:17194226-17194248 TCCAAGGCCAATGTCCAGAGTGG - Intronic
1066592665 10:37012599-37012621 TCCCAGTGCCCTCTCCACAAAGG - Intergenic
1067210837 10:44259440-44259462 TTCAAAGGCCATCTACAGAGAGG - Intergenic
1067552626 10:47246257-47246279 TCCCAGGGTCAACTCCATATAGG - Intergenic
1070391825 10:75977643-75977665 CCCCAGGGTGATCTCTAGAGAGG + Intronic
1070544897 10:77444680-77444702 TCCCAGGACAATCTCCAGAGTGG - Intronic
1070779389 10:79128713-79128735 TCCCCAGGGCACCTCCAGAGTGG + Intronic
1071022695 10:81077478-81077500 TGCCAGGGCTATGTCCAGAATGG + Intergenic
1071294399 10:84208764-84208786 ACCCAGGGGCATCTTCCGAGTGG + Exonic
1073139827 10:101239737-101239759 TCCCATGGGCATCTCCAGGTAGG - Intergenic
1073487408 10:103828426-103828448 TCTCAGGGCCACCCCCAGGGAGG - Intronic
1074002885 10:109390090-109390112 ACCCAGGGCCATGTCCAGCCTGG - Intergenic
1075042901 10:119122839-119122861 TTCCATGGCAGTCTCCAGAGTGG + Intronic
1075529891 10:123220081-123220103 TTCCAGAGCCATCATCAGAGAGG + Intergenic
1075645840 10:124095448-124095470 GCCCAGCGCCATCTCCATAACGG - Intergenic
1075778475 10:125002657-125002679 ACCCAGTGCCGCCTCCAGAGGGG - Intronic
1076057067 10:127384458-127384480 ATCCAGGGCCATCCCAAGAGCGG - Intronic
1076675671 10:132146387-132146409 GTCCAGGGCCATCCCAAGAGGGG + Intronic
1076679075 10:132162217-132162239 TCCCACACCCATGTCCAGAGAGG - Intronic
1076907633 10:133371377-133371399 GTCCAGGGCTGTCTCCAGAGTGG - Intronic
1077333056 11:1991759-1991781 TCCCACCCCCATCTCTAGAGAGG + Intergenic
1077730875 11:4728351-4728373 TCCGAGGGCAATTTCTAGAGAGG - Intronic
1078139072 11:8678871-8678893 TCCCAAGGCCACCTGGAGAGAGG + Intergenic
1078345200 11:10541449-10541471 TCCTGGTGCCATCTCCGGAGCGG + Intergenic
1078619442 11:12893665-12893687 TCCCAGCACCATCTCTACAGAGG - Intronic
1080039244 11:27741693-27741715 TCCCAGAGACATAGCCAGAGTGG - Intergenic
1081642074 11:44762965-44762987 TGCTAGTGCCATCTCCACAGTGG - Intronic
1082703147 11:56458899-56458921 TCCAAGGCCCATGTCCAGAAGGG - Intergenic
1084083746 11:66845291-66845313 TCCCAATTCCTTCTCCAGAGTGG - Intronic
1084934343 11:72579074-72579096 TCCCAGGGCCCAACCCAGAGCGG + Intronic
1085200701 11:74700059-74700081 CCCCAGTGCCACCTCCACAGAGG - Intronic
1085457239 11:76671995-76672017 CCCCAGATCCATCTCCACAGTGG - Intergenic
1086192764 11:84098978-84099000 TGCCAGGGTCATCTCCAATGTGG + Exonic
1086517044 11:87624905-87624927 TCCTAAGGCCATTTCAAGAGGGG - Intergenic
1090435929 11:126686261-126686283 TCCCAAGGCCTGCTCCAGACTGG + Intronic
1202816039 11_KI270721v1_random:46937-46959 TCCCACCCCCATCTCTAGAGAGG + Intergenic
1092529759 12:9334771-9334793 TCCCAGGACCAACTCTAAAGTGG + Intergenic
1093315911 12:17649208-17649230 TCCCATGGCCAACTCCACATAGG + Intergenic
1094637830 12:32243932-32243954 TCCCAGTGCCATTTACAGTGTGG + Intronic
1095616440 12:44195261-44195283 GGCCAGGGCCATTTCCAGAAAGG - Intronic
1095991534 12:48037835-48037857 TCCCCAGGTCATCCCCAGAGAGG + Intergenic
1097335656 12:58380082-58380104 TCCCAGGGCCTTCCCAAGACTGG - Intergenic
1097684156 12:62676574-62676596 TCCCAGTGCCTACTCCAGTGTGG + Intronic
1099199626 12:79660262-79660284 TCCTAGGGCAATCTTCATAGTGG + Intronic
1100144445 12:91660256-91660278 TCCCAGGTCTCTCTGCAGAGAGG + Intergenic
1102587663 12:113934396-113934418 TCTCAGGGCCATTTCCCCAGGGG + Intronic
1103091082 12:118098484-118098506 TCCCAGTGCTTTGTCCAGAGTGG - Intronic
1104343811 12:127977544-127977566 TCACCTGGCCAGCTCCAGAGTGG - Intergenic
1104717816 12:131028049-131028071 GCCCGGTGCCTTCTCCAGAGCGG + Intronic
1105779623 13:23695384-23695406 GCCCAGGGCCCTCTCCAGGTAGG + Intergenic
1107228975 13:38085994-38086016 TCCCAGAGCCCACTCCAGTGTGG + Intergenic
1108310749 13:49187598-49187620 TCCCAGGGCCCTCCTCACAGTGG + Intronic
1110905466 13:80882172-80882194 TCCCATGACCATCTGCACAGGGG - Intergenic
1113819595 13:113203809-113203831 TCCCAGGGCCAACTACTGATGGG - Intronic
1115224394 14:31088030-31088052 ACCCAGGGCCTTCTCCAGCATGG + Intronic
1116221818 14:42096729-42096751 TCCCAGGGGCCGCTTCAGAGGGG + Intergenic
1117414821 14:55485081-55485103 TCACAGGTACATCACCAGAGTGG - Intergenic
1117933946 14:60880326-60880348 TCCCAGGTTCATTTCCAGAATGG - Intronic
1118192646 14:63594478-63594500 ACCCAGGGCCTTCCCCAGGGTGG + Intergenic
1119400386 14:74358626-74358648 GCCCAGGGCCAGCCCCACAGTGG + Exonic
1119806809 14:77487584-77487606 TCCCAAGAGCAGCTCCAGAGAGG - Intronic
1120025423 14:79578440-79578462 TCTCAGGTCTATCTCCTGAGGGG - Intronic
1120035355 14:79690797-79690819 TTGCAGGGCCATCTCCATATAGG - Intronic
1120565619 14:86052580-86052602 TCCAAGGTGCATCTACAGAGAGG + Intergenic
1121302402 14:92881810-92881832 TCCCAAGCCCATCCCCAGAAGGG - Intergenic
1122958861 14:105085398-105085420 TCCCAGGGCCAGCTCCATGGAGG - Intergenic
1123611584 15:22099355-22099377 CCCCAGGTCCAACACCAGAGCGG + Intergenic
1125599204 15:40906469-40906491 CCCCAGGGCCCTCTCCAGGGCGG - Intergenic
1126138401 15:45414671-45414693 GGCCAGGGCCCTCACCAGAGTGG - Exonic
1126674756 15:51150836-51150858 CCCAAGGCCCATGTCCAGAGTGG - Intergenic
1127979789 15:64026129-64026151 TTCCAGGGCCTTCCACAGAGGGG - Intronic
1128251989 15:66170267-66170289 TGCCAGGGGCGTTTCCAGAGAGG + Intronic
1130064985 15:80595776-80595798 TCCCAGGGCCAGCCCCAGAATGG + Exonic
1132115205 15:99131038-99131060 TCCCAGCGCCCTCTCTGGAGGGG + Exonic
1132115212 15:99131047-99131069 ACCCAGGTCCCCCTCCAGAGAGG - Exonic
1132587469 16:711815-711837 TCCCCAGGCCTCCTCCAGAGAGG - Intronic
1132677220 16:1125804-1125826 AGCCTGGCCCATCTCCAGAGGGG - Intergenic
1133126606 16:3651483-3651505 CCCCAGGCCTATCTCCAGAGTGG + Intronic
1134015685 16:10886550-10886572 TGCCAGGTCGTTCTCCAGAGCGG + Intronic
1134034066 16:11016209-11016231 TACCTTGGCCATCTCCAAAGTGG - Intronic
1134656366 16:15950524-15950546 TCTAAGGGGCATCCCCAGAGAGG - Intronic
1136235535 16:28911347-28911369 TGCCAGGTCCACCTCCAAAGTGG + Intronic
1136677954 16:31931045-31931067 TGCCAAGGCCATGTCCAGAATGG - Intergenic
1136985631 16:35101599-35101621 TTCCAGGTCCATCTTCACAGTGG - Intergenic
1137375653 16:47949708-47949730 TGCCAGAGCCAACTCCAGAGAGG + Intergenic
1137568220 16:49547578-49547600 TCCCTGGGTCAGCTCCACAGTGG + Intronic
1137720718 16:50625869-50625891 CCTTGGGGCCATCTCCAGAGAGG - Intronic
1137788679 16:51156038-51156060 ACCAAGGGCTATCTCCAGACGGG + Intergenic
1138655115 16:58486955-58486977 TCCCTGGCCCATCTTCACAGAGG + Intronic
1139558940 16:67729652-67729674 TCCCAGAGCCCTCTGGAGAGTGG + Intronic
1140017565 16:71202870-71202892 ACCCACTGCCCTCTCCAGAGAGG + Intronic
1141443094 16:84042001-84042023 CCCCTGGGCCTTCTCCAAAGCGG - Exonic
1142366337 16:89651925-89651947 ACCCAAGGCCTCCTCCAGAGCGG + Intronic
1143317645 17:6044606-6044628 TCCCAGGGCCACCACCCCAGAGG - Intronic
1144862535 17:18314686-18314708 TCGGAGGGCCATCTCCATGGCGG + Exonic
1146687457 17:34850933-34850955 TCCCAGGGTAAGCTCCAGGGTGG - Intergenic
1147966543 17:44197263-44197285 TCCCAGGCACTTCTCCAGATGGG + Exonic
1148666637 17:49379757-49379779 TCCGAGGGCCCTCTCCTGAATGG - Intronic
1149896088 17:60429536-60429558 TCCCAGGACCATGTCAAGAAAGG + Exonic
1151534391 17:74730514-74730536 TCCCAGGGCTCTCCCCAGACTGG + Intronic
1152240270 17:79157282-79157304 CCACAGGGCCAGCTGCAGAGTGG - Intronic
1152289759 17:79433214-79433236 TCCCAGGGCCACCTTGGGAGAGG + Intronic
1152624514 17:81382092-81382114 TCCCGTGCCCATCGCCAGAGAGG - Intergenic
1152644643 17:81463155-81463177 TCCCAGGTCCCTCCCCACAGTGG + Intronic
1152657587 17:81527222-81527244 TCCTGGGCCCATCTCCTGAGTGG - Intergenic
1153608014 18:6854589-6854611 TCACAGAGGCAGCTCCAGAGGGG - Intronic
1155378328 18:25187691-25187713 TCCCAGGGCTCTCTCCATTGAGG + Intronic
1156182004 18:34615748-34615770 TACCAGGGCCTACTTCAGAGTGG - Intronic
1156373158 18:36489332-36489354 TGCCATGGCCATCTCAGGAGAGG + Intronic
1156491946 18:37501543-37501565 TCCCAGGCCCATCCCCAGGCAGG - Intronic
1156493088 18:37507957-37507979 CCCCACAGCCATCTCCAAAGTGG + Intronic
1158083789 18:53626154-53626176 TCCCAGAGCCACAGCCAGAGTGG + Intergenic
1158127570 18:54118727-54118749 TTCCAGAGACATCTCAAGAGAGG - Intergenic
1158371155 18:56805933-56805955 TCCCTGGCGCATCTACAGAGCGG - Intronic
1159023410 18:63161617-63161639 TCCTAGGGCCATTTACAAAGTGG + Intronic
1161505614 19:4641769-4641791 TCCCAGAGCCCACCCCAGAGGGG - Intronic
1161805846 19:6442479-6442501 TCCCAGAGCCAGCTCCCCAGGGG + Intronic
1162033637 19:7927756-7927778 GCCCATGGCCAGCTGCAGAGGGG + Exonic
1162788459 19:13050949-13050971 GCCCAGGGCCATCTCCAAGGGGG - Intronic
1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG + Intronic
1163163470 19:15479640-15479662 AGCCAGGCCCATCCCCAGAGGGG + Exonic
1163243401 19:16077368-16077390 TCCCGGGGCCTTCTGGAGAGAGG - Intronic
1163600572 19:18246980-18247002 TCCCAGGCCCATCACCTGAGTGG - Intronic
1163953549 19:20613177-20613199 GACCAGGGCCACATCCAGAGGGG + Intronic
1165170505 19:33888644-33888666 ACCCAGTCCCATCTGCAGAGTGG + Intergenic
1166415908 19:42594852-42594874 TCCCAGGCTCATCTCCACAGAGG - Exonic
1166435766 19:42765605-42765627 TCCTAGGCTCATCTCCACAGAGG - Exonic
1166453034 19:42917816-42917838 TCCTAGGCTCATCTCCACAGGGG - Exonic
1166455526 19:42937100-42937122 TCCTAGGCTCATCTCCACAGAGG - Exonic
1166465315 19:43026396-43026418 TCCTAGGCTCATCTCCACAGAGG - Exonic
1166471439 19:43082593-43082615 TCCTAGGCTCATCTCCACAGAGG - Exonic
1166492211 19:43269455-43269477 TCCCAGGCTCATCTCCACAGAGG - Exonic
1166496132 19:43304558-43304580 TCCCAGGCTCATCTCCACAGAGG - Intergenic
1167594054 19:50418255-50418277 CCCCAGGGTCATCACCAGGGAGG - Intronic
1167973097 19:53201214-53201236 TCCCAGGACCATGCCCAGTGGGG - Intergenic
1167988964 19:53341519-53341541 TCCCAGGACCATGCCCAGTGCGG - Intronic
925247662 2:2398887-2398909 TCCCACGCCCATCTCCATAGCGG + Intergenic
925362999 2:3292524-3292546 CCCCAGAGCGATCTCCAGATAGG + Intronic
925609360 2:5691469-5691491 TCCCAGGGCTGGCTCCGGAGCGG - Intergenic
926704222 2:15825457-15825479 TCCCTGGTCCATCTGAAGAGGGG + Intergenic
927143610 2:20145983-20146005 TCCCTTGGGCCTCTCCAGAGAGG + Intergenic
928013504 2:27632561-27632583 TCACAGAGCCCTCTCCAGGGTGG - Intronic
928404816 2:31006629-31006651 TCCCAGGTCTATCTCCAGACAGG - Intronic
928893707 2:36236961-36236983 TGGCAATGCCATCTCCAGAGTGG - Intergenic
931691356 2:64837278-64837300 CCCCAGGGCCAGCTCTAGTGTGG + Intergenic
932419329 2:71592257-71592279 TACCAATGCCGTCTCCAGAGGGG - Intronic
932499898 2:72174150-72174172 GCCCAAGGCCTTGTCCAGAGAGG - Intergenic
934719599 2:96564427-96564449 GCCCATGGCCATCTCCAGAGTGG + Intergenic
935443003 2:103123598-103123620 TCCATGGGCCATTTCCAGAGAGG + Intergenic
937154680 2:119710574-119710596 TCCAAGTGCCATCTCCCAAGGGG - Intergenic
938177028 2:129143153-129143175 TTCCAGGGACATCTCTAGTGAGG - Intergenic
938262717 2:129906885-129906907 TCCCAGGGCCATCCCCAGGGTGG + Intergenic
939801801 2:146720376-146720398 TCCCAGTGCCTGCTCCAGTGTGG + Intergenic
941993576 2:171579900-171579922 TCTCAGGCCCCACTCCAGAGAGG - Intergenic
942829140 2:180218190-180218212 TGCCAGGGCCTTTTCCAGAATGG - Intergenic
944447896 2:199810148-199810170 TTCCAAGGCCATCTCCATGGGGG + Intronic
944661589 2:201926126-201926148 TCCAAGGGGCAGCTCCAGAGGGG - Intergenic
945019524 2:205557051-205557073 GCACAGAGCCATCTGCAGAGAGG - Intronic
945477707 2:210304923-210304945 TCCCAGTACCATTTCCAGAAGGG - Intronic
946393467 2:219430645-219430667 GCCCAGTGGCACCTCCAGAGAGG + Intergenic
1169304208 20:4474327-4474349 CCCCAGAGCCAGCTCCAGACTGG - Intergenic
1170684739 20:18559238-18559260 TAACAAGGCCATCTCCACAGCGG - Intronic
1171406543 20:24915655-24915677 TGCCAAGGGCAACTCCAGAGAGG + Intergenic
1171423226 20:25032810-25032832 TCCCAAGGCCATCTGCAGAGGGG + Intronic
1171849728 20:30299803-30299825 GCCCAGGTCCTTCTCCAGGGAGG - Intergenic
1172271050 20:33656139-33656161 TCCCTGGGCCACCTGCACAGAGG - Intergenic
1172334201 20:34100366-34100388 TCCCCCTGCCACCTCCAGAGAGG - Intronic
1172977902 20:38920196-38920218 TGCCATGGGCATCTCCAAAGGGG - Exonic
1174051955 20:47773093-47773115 TCCCAGGCCAAGCTCCAGCGGGG - Intronic
1174225979 20:49000432-49000454 TCTCAAGGCCACCTCCAAAGAGG - Intronic
1175183874 20:57166901-57166923 CACCGGGGCCATCTACAGAGTGG - Intergenic
1175278426 20:57787481-57787503 TTCCAGGGTCATCTCTTGAGAGG - Intergenic
1175371480 20:58495856-58495878 TGCCAGGGCCATCAGCGGAGTGG + Intronic
1175568446 20:59999748-59999770 TCCCAGTGCCACATCCAGGGAGG + Intronic
1175892652 20:62322358-62322380 TCCGAGTGCCACCCCCAGAGCGG - Exonic
1176305745 21:5122248-5122270 TCTCAGGACCCTCTCCTGAGAGG + Intronic
1176905035 21:14490357-14490379 TCCTGGGGCCATCTCCAAAGTGG + Intronic
1177855548 21:26396734-26396756 TCACTGAGCCCTCTCCAGAGTGG + Intergenic
1179249876 21:39663912-39663934 ACCCAGCGCTAGCTCCAGAGTGG + Exonic
1179851313 21:44139783-44139805 TCTCAGGACCCTCTCCTGAGAGG - Intronic
1180593655 22:16960364-16960386 TTCAAGTCCCATCTCCAGAGGGG - Intergenic
1181632711 22:24159645-24159667 TCCCAGGGCCATGCCCAGCTGGG - Intronic
1183336113 22:37247567-37247589 TCCCAGGACCACCTGCAGATGGG - Intergenic
1183439517 22:37815468-37815490 ACCCAGGGCCTTCCCCAGGGTGG - Exonic
1183442289 22:37830079-37830101 TCCCAGGGCCATGGCCATGGGGG + Intergenic
1183670340 22:39269110-39269132 TCTCAGGCCCATGTCCACAGTGG - Intergenic
1185375879 22:50482386-50482408 TCCCAGGCCCAAGCCCAGAGGGG + Intronic
1185388228 22:50546274-50546296 TCCCAGTCCCAGCCCCAGAGGGG - Intergenic
949873155 3:8606499-8606521 TCCCAGGGCCCAGTCTAGAGTGG + Intergenic
950425524 3:12923004-12923026 TCCCAGGGCCATCTCCACATGGG + Intronic
951566943 3:24020253-24020275 TCCCAGCGCCCACTCCACAGTGG - Intergenic
953383795 3:42493308-42493330 TCCCAAGGCCCTCTCGAGAGTGG - Intronic
953496511 3:43392067-43392089 TCACAGGGTCCTCACCAGAGAGG + Intronic
954332709 3:49899372-49899394 GCCCAGGGCCTTCTCCAGTCAGG - Intronic
954535599 3:51357251-51357273 TTCCAGGACCATGTCAAGAGAGG - Intronic
954883188 3:53849649-53849671 TCCCAGGGCCATCTCCAGAGTGG + Exonic
954934632 3:54315198-54315220 TTCCAGGGCCCCCTCCAGAATGG + Intronic
955309545 3:57872022-57872044 TCTGAGGGCCATCTTCAGAATGG - Intronic
956713557 3:72058919-72058941 TCCCAGGGAAAACTCTAGAGAGG - Intergenic
960122295 3:113959029-113959051 TCTCAGGGTCATCTGCAAAGTGG + Intronic
961469236 3:127101009-127101031 GCCCAGGGCCAGCTCTAGAGGGG + Intergenic
962385414 3:134928740-134928762 TCCCAGGGGAGTGTCCAGAGAGG + Intronic
964500016 3:157339053-157339075 TCCCAGGGCCAGAACTAGAGTGG - Intronic
965466669 3:169038303-169038325 TCCAAGGCCCATGTCCAGAATGG - Intergenic
966700369 3:182842587-182842609 TCTTAAGGCCATCCCCAGAGAGG - Intronic
967670858 3:192233618-192233640 TGCCAAGGTCATGTCCAGAGTGG + Intronic
967711169 3:192710023-192710045 TACCAAGGTCATCTCCAGACAGG - Intronic
968503360 4:961185-961207 CCCCAGGGCCAGGTCCAGGGTGG - Exonic
968503404 4:961304-961326 CCCCAGGGCCAGGTCCAGGGTGG - Intronic
968503430 4:961366-961388 CCCCAGGGCCAGGTCCAGGGTGG - Intronic
968910336 4:3474083-3474105 TTCCAGGGCCAGTTCCACAGGGG - Intronic
969197129 4:5571934-5571956 TCCCAAGGCCATCTGCTGAAAGG - Intronic
970506945 4:16741363-16741385 GTCCAAGGACATCTCCAGAGAGG + Intronic
976228540 4:82816578-82816600 GCCCAAGACCATCTGCAGAGTGG - Intergenic
980020886 4:127708377-127708399 TCCCAGGGTCATGTCCTGGGAGG - Intronic
980404426 4:132338094-132338116 TCCCACGTCAGTCTCCAGAGTGG - Intergenic
980578777 4:134720970-134720992 TGTCAGGGCCATGTCCAGAATGG - Intergenic
981858598 4:149326552-149326574 TAGCAAGGCTATCTCCAGAGAGG - Intergenic
982162977 4:152588409-152588431 TCCCAGGGCCCTCTCTAGCTTGG + Intergenic
982422029 4:155208973-155208995 TTCCAGGGCCCTCTCCAGGTCGG + Exonic
983277136 4:165631626-165631648 TCCCATAGCCATTACCAGAGAGG + Intergenic
983518995 4:168687460-168687482 TCCCAAGGTCATCACCAGAAAGG + Intronic
985527188 5:412002-412024 TCCCGGGGCCATCACCGGTGAGG - Intronic
986132358 5:4943067-4943089 ACCCAGGGCCAGCACCAGAGTGG + Intergenic
987746196 5:21975319-21975341 TGCCAGCGCCATCTCCTGAGAGG + Exonic
988606331 5:32681452-32681474 TTTCAGGGCCACCTCCAGACAGG + Intergenic
988682381 5:33496412-33496434 TCTCAAGACCATCCCCAGAGAGG - Intergenic
990183268 5:53186093-53186115 GCCCATGGCCATGTCCTGAGTGG + Intergenic
991147903 5:63328867-63328889 TCCAAGGCCCATGTCCAGAATGG + Intergenic
991766403 5:69985430-69985452 TGCCAGCGCCATCTCCTGAGAGG + Intergenic
991780915 5:70132723-70132745 TGCCAGCGCCATCTCCTGAGAGG - Intergenic
991845636 5:70860513-70860535 TGCCAGCGCCATCTCCTGAGAGG + Intergenic
991873361 5:71133037-71133059 TGCCAGCGCCATCTCCTGAGAGG - Intergenic
993332528 5:86618106-86618128 TCCCAGGGCCCTCCTCATAGTGG - Exonic
993559786 5:89391733-89391755 CACCAGTGCCATCTCCACAGGGG + Intergenic
994618804 5:102138276-102138298 TCCAAGGTCCATCTGCATAGTGG + Intergenic
996709672 5:126531945-126531967 TCCCAGGGCTCTCTCCACTGTGG - Intergenic
997671039 5:135672199-135672221 TCCCTGGAACATCTCCAGAAGGG - Intergenic
997735946 5:136212682-136212704 TCCCAAGGCCACCTCCAGACTGG + Intergenic
998139517 5:139692006-139692028 TCCCTGGGCTCTCTCCAGTGTGG - Intergenic
1000361527 5:160452256-160452278 GCCCAGGGCCCTATCTAGAGAGG + Intergenic
1002058743 5:176613673-176613695 TCCCAGTGCCAGCTCTAGGGTGG + Intergenic
1002719947 5:181252747-181252769 TACCAGGGCCACCTCCACTGTGG + Intergenic
1002841596 6:911469-911491 TCTCGGGGCCATCTACAGACAGG + Intergenic
1004720907 6:18266438-18266460 TCCCAGGGCCCACTCCAAGGCGG - Intergenic
1008556669 6:52679245-52679267 TCCCAGGTAGGTCTCCAGAGAGG + Intronic
1009471736 6:64034518-64034540 TCCCAACGCCATCTCCACATTGG + Intronic
1010036426 6:71330804-71330826 TACCAGGAACTTCTCCAGAGAGG + Intergenic
1012448799 6:99333382-99333404 TGAAAGAGCCATCTCCAGAGCGG - Exonic
1013055091 6:106575451-106575473 TTCCAAGGCCACATCCAGAGAGG - Intronic
1015316649 6:131824418-131824440 TGCCAGAGCCATCTCCAGGCAGG + Intronic
1015922073 6:138276270-138276292 TCCTAAGGCCATCTGCAGACAGG - Intronic
1017787876 6:157771665-157771687 TGCCAGGGACATATCCAGAGTGG + Intronic
1018182718 6:161238128-161238150 TCTCAGTGCCCTCTCCACAGCGG - Intronic
1027809209 7:82871787-82871809 TCCCTGAGCCATCTCTAGAGTGG - Intronic
1029622705 7:101699975-101699997 TCCCAGGGCCCTCTCCACTGTGG + Intergenic
1032363377 7:131276461-131276483 TCCTAGGGCCAAATCCCGAGAGG + Intronic
1033259558 7:139831122-139831144 TACCAGGGCCTCCTCCAGACTGG - Intronic
1035031131 7:155861388-155861410 CCCCAGGGCCAGCACCAGGGTGG + Intergenic
1035044704 7:155956046-155956068 TCCCAGGACCACCTCCAGGGTGG - Intergenic
1035764962 8:2098511-2098533 GCCCAGGGCCAACTCAAGGGCGG - Intronic
1042020411 8:64368423-64368445 TCCTTGCTCCATCTCCAGAGGGG + Intergenic
1042613538 8:70624201-70624223 GCCCAGAGCCTTCTCCAGATTGG - Intronic
1044021540 8:87111482-87111504 CCCCAAGTCCATCTCCAAAGAGG - Intronic
1044848010 8:96400404-96400426 TCCCAGGGCCTAATCCAGTGTGG - Intergenic
1046777046 8:118175412-118175434 GCCCAGGGCAATGTCCAGAATGG - Intergenic
1047726277 8:127686719-127686741 TCCCAGGGCAATGTCTAGATGGG - Intergenic
1049606816 8:143533376-143533398 GCACAGGGCCAGCTGCAGAGAGG - Intronic
1050295705 9:4202888-4202910 TCCCATGGCAATGTCCAGAATGG - Intronic
1051949642 9:22616150-22616172 TCCCAGGCCTATCTACTGAGAGG - Intergenic
1052793145 9:32896551-32896573 TGCCAGGGCTATGTCCAGAGTGG + Intergenic
1053011977 9:34638675-34638697 TCCCAGCTCTATCTCCAGACTGG - Intronic
1053131567 9:35618505-35618527 TCCCTGGGCCAGGGCCAGAGGGG + Intronic
1053309894 9:37011226-37011248 CCCCAGGGCCACCTCCAGCCCGG + Intronic
1053487925 9:38474500-38474522 GCTCAGGGTGATCTCCAGAGCGG - Intergenic
1054157623 9:61651672-61651694 GCCCAGGTCCTTCTCCAGGGAGG + Intergenic
1054477397 9:65582677-65582699 GCCCAGGTCCTTCTCCAGGGAGG + Intergenic
1056099580 9:83287855-83287877 TCCCACTGCCATCTCCCCAGTGG + Intronic
1057245545 9:93451725-93451747 TCCCAGGGCCATGTCTGGGGAGG - Exonic
1057742734 9:97726318-97726340 TCTCTGGGCCGTCTCCAGAGAGG - Intergenic
1057749795 9:97782821-97782843 TCCCAGTGCCATAACCAGAGAGG + Intergenic
1059325606 9:113502432-113502454 TCCCAGGGAGATGCCCAGAGGGG + Intronic
1059870974 9:118575911-118575933 TCCAAGGCCAATATCCAGAGTGG + Intergenic
1060186921 9:121569078-121569100 TCCCAGGCCCAGCTGGAGAGGGG + Intronic
1060896720 9:127223640-127223662 GACCAGGGGCATCTCTAGAGGGG + Intergenic
1061206479 9:129166869-129166891 TCCCAGGGCCATCTCTACCCAGG - Intergenic
1062146905 9:134994564-134994586 TACCAGGGCCACCTGCATAGGGG + Intergenic
1203790785 EBV:150622-150644 GCACAGGGCCATCTCCAGGGCGG - Intergenic
1186471425 X:9824934-9824956 TCCCGAGGCCATCTCGAGATGGG - Intronic
1190126364 X:47709057-47709079 TCCCTGGGCCATCTCCTGCTGGG + Intergenic
1194756044 X:97741205-97741227 TCCCAGCCCCTTCTCCAGAGAGG - Intergenic
1195471558 X:105235962-105235984 TCCCAGGCCCATTGCCGGAGAGG - Intronic
1200114297 X:153763383-153763405 TGGCAGGGCCATCCACAGAGGGG - Intergenic