ID: 954886990

View in Genome Browser
Species Human (GRCh38)
Location 3:53883428-53883450
Sequence AGTTATCTTCAGCACATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 341}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954886985_954886990 12 Left 954886985 3:53883393-53883415 CCCACACTAGAATGTAAGCTCCG 0: 1
1: 6
2: 53
3: 335
4: 1053
Right 954886990 3:53883428-53883450 AGTTATCTTCAGCACATGGTAGG 0: 1
1: 0
2: 3
3: 33
4: 341
954886984_954886990 26 Left 954886984 3:53883379-53883401 CCTGCTCACTGTCTCCCACACTA 0: 1
1: 1
2: 2
3: 31
4: 287
Right 954886990 3:53883428-53883450 AGTTATCTTCAGCACATGGTAGG 0: 1
1: 0
2: 3
3: 33
4: 341
954886986_954886990 11 Left 954886986 3:53883394-53883416 CCACACTAGAATGTAAGCTCCGT 0: 4
1: 31
2: 225
3: 740
4: 1710
Right 954886990 3:53883428-53883450 AGTTATCTTCAGCACATGGTAGG 0: 1
1: 0
2: 3
3: 33
4: 341
954886987_954886990 -8 Left 954886987 3:53883413-53883435 CCGTGAGACTTTGCCAGTTATCT 0: 1
1: 0
2: 1
3: 10
4: 185
Right 954886990 3:53883428-53883450 AGTTATCTTCAGCACATGGTAGG 0: 1
1: 0
2: 3
3: 33
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954886990 Original CRISPR AGTTATCTTCAGCACATGGT AGG Intergenic
901466303 1:9423509-9423531 ATTTCTCTACAGCACATGGTTGG + Intergenic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905465224 1:38148097-38148119 AGTTATCTGAAGAAGATGGTAGG - Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
909612253 1:77563966-77563988 AGTTCTCTTCAGTACATAGCAGG - Intronic
910007427 1:82415999-82416021 AGGTACCTTCACCACAAGGTGGG + Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910747127 1:90586170-90586192 AGTTATCTCCATCAAAAGGTAGG - Intergenic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
916474150 1:165152680-165152702 AGTTATTTACAGGGCATGGTGGG - Intergenic
917190191 1:172408627-172408649 ACTTATATTCACCTCATGGTAGG + Exonic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917917711 1:179720893-179720915 AGTGATTTTCAGCAGCTGGTGGG + Intergenic
917981146 1:180270214-180270236 AGTCAACACCAGCACATGGTAGG + Intronic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918958242 1:191237947-191237969 AGTTGTCTTCAGAAGATGGCAGG - Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
922583252 1:226714125-226714147 AGTTCTCCTGGGCACATGGTAGG + Intronic
924459630 1:244247554-244247576 AATTATGTTCAGCTCTTGGTTGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067844457 10:49708884-49708906 AGTTCACTTCAGAAGATGGTGGG - Exonic
1067986491 10:51152497-51152519 TGTTACCTTCAGTAAATGGTGGG - Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068875168 10:61987968-61987990 AATGATTTTCAGCAGATGGTAGG + Intronic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074914589 10:117943156-117943178 GATTGTCTTGAGCACATGGTAGG - Intergenic
1075100091 10:119500339-119500361 AGTATTCTTTGGCACATGGTAGG - Intronic
1076102795 10:127796597-127796619 AGTTATCACCAGCACAAGGAAGG - Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077846950 11:6035760-6035782 TGTTATGTTCAGAAGATGGTGGG - Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1086034732 11:82402814-82402836 TTTTATGTTCAGCACATGGCTGG - Intergenic
1087455464 11:98380315-98380337 AGTTAATTTCAGCATATGATAGG + Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088385395 11:109248794-109248816 AGTTAGCATCAGTACAGGGTGGG - Intergenic
1088587361 11:111370864-111370886 AATTATCTTCAGCAGAAGGTGGG - Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091312355 11:134583746-134583768 AGATGTTTTCAGCACATTGTGGG - Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092598224 12:10030790-10030812 TGTTTTCTTCAGGACAAGGTAGG - Exonic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093048527 12:14481225-14481247 AGTTCTCTTCAGCATTTAGTTGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095683124 12:45001972-45001994 AGTTATCTACAGTACATGTGGGG - Intergenic
1095708030 12:45258950-45258972 AAGTATCTTCAGAAAATGGTGGG + Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097051689 12:56227018-56227040 AGATATCTGCAGCCCATGGCTGG - Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099735783 12:86565012-86565034 AGTTATCTGCAGAAGATAGTAGG - Intronic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101080933 12:101183587-101183609 TGATATTTACAGCACATGGTAGG - Intronic
1101128449 12:101663924-101663946 AGTTAACTTCAGCTCATTATAGG - Intronic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1107063539 13:36187615-36187637 ACTAATCTTCAGCAGATGGAGGG + Intronic
1109149369 13:58824822-58824844 AGTTTTCTGCAGCATGTGGTTGG - Intergenic
1109694985 13:65942894-65942916 AGTTATCTTAAACACATATTTGG + Intergenic
1110823415 13:79943204-79943226 TTTTATCTTCAGCACTTAGTAGG + Intergenic
1110865116 13:80385102-80385124 AGTTATCTTGAGGCCATTGTTGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1113338868 13:109402763-109402785 AGTGATCTCCTGCACATGGCTGG - Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114898982 14:27032709-27032731 AGTTACATTCAACACATGGTAGG + Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118035937 14:61865753-61865775 ATTTTTTTTCAGCACATGGAGGG + Intergenic
1118427815 14:65686132-65686154 AGGTGTCTTCTCCACATGGTAGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120629177 14:86867691-86867713 AATTATTTTCAGCCCATGGTTGG - Intergenic
1121004820 14:90483493-90483515 TGTCATCTTCAGCACCTGCTGGG + Intergenic
1122396462 14:101436151-101436173 TGTTATCTTAAGCACAGGGGAGG - Intergenic
1123738892 15:23215171-23215193 AGTTATACTCAGCATGTGGTTGG + Intergenic
1124142639 15:27090336-27090358 AAGTATTTTCAGCATATGGTGGG + Intronic
1124290112 15:28444142-28444164 AGTTATACTCAGCATGTGGTTGG + Intergenic
1124293126 15:28473426-28473448 AGTTATACTCAGCATGTGGTTGG - Intergenic
1125276919 15:38003483-38003505 AGTTATCCTTGGCCCATGGTGGG + Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127922338 15:63503877-63503899 CGTTACCTCCAGCACATCGTAGG - Intergenic
1129354157 15:74977960-74977982 AACAATCTTTAGCACATGGTGGG + Intronic
1130022830 15:80245447-80245469 AGTTACCTTCAGATCCTGGTTGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1132905337 16:2279633-2279655 AGCTACCTTCAGCAGCTGGTCGG + Intronic
1135871728 16:26157353-26157375 AGTTATGTTTAACAAATGGTTGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138253928 16:55535281-55535303 AGTTGCCTTAAGCACATTGTAGG + Intronic
1138553137 16:57757963-57757985 AGTTATCGTGGGCACATGGTAGG + Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156166804 18:34430950-34430972 AGTTATCTTAGGCCCATGATAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1161605486 19:5212535-5212557 GGGCATCTTCAGCACATGGGTGG - Intronic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
929969534 2:46562095-46562117 ACTTATCGGCAGCACAGGGTGGG + Intronic
932843369 2:75107205-75107227 ACATATCTTCAGCACATGTAAGG + Intronic
933540644 2:83637623-83637645 AGCTTTCTGCAGCATATGGTTGG - Intergenic
935183932 2:100714870-100714892 AGTTATTTTCAGAAGATGGTAGG - Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935859007 2:107307140-107307162 AGTTATTCTCAGCACATGTATGG - Intergenic
937464304 2:122116921-122116943 TGTCATTTTCAGCACATGGATGG - Intergenic
938077817 2:128349692-128349714 ATTGATCATCAGAACATGGTGGG - Intergenic
938166554 2:129033543-129033565 AGTTAATTTCTGCATATGGTGGG - Intergenic
938173939 2:129107137-129107159 AGGTATCTCCTGCAGATGGTGGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942662033 2:178275653-178275675 AGTAGTCTCCAGCAAATGGTAGG + Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943693335 2:190893082-190893104 AATTATTTACAGCAAATGGTTGG - Intronic
943872703 2:193022025-193022047 ATTTATCATCTGCACCTGGTTGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947686357 2:232089087-232089109 AGGTATCTTCAGGACATGACTGG + Intronic
1171725715 20:28619141-28619163 AGTTATATCCAGCACATGGAGGG - Intergenic
1171752353 20:29063961-29063983 AGTTATACCCAGCACATGGAGGG + Intergenic
1171857799 20:30363217-30363239 ACTTATATCCAGCACATGGAGGG + Intergenic
1171967654 20:31542582-31542604 AGGTATCTTCACCCCAGGGTAGG + Intronic
1173909941 20:46659854-46659876 AGTTATCTTCAGCACATACTTGG - Intronic
1174109200 20:48186236-48186258 AGTTCTCTTCTGCACGTGGCTGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180390616 22:12278748-12278770 AGTTATATCCAGCACATGGAGGG - Intergenic
1180409127 22:12586009-12586031 AGTTATATCCAGCACATGGAGGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951077822 3:18418225-18418247 AGTCATCTTCAGAAGTTGGTAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
954886990 3:53883428-53883450 AGTTATCTTCAGCACATGGTAGG + Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956872127 3:73428448-73428470 TGTTACTCTCAGCACATGGTTGG - Intronic
957120088 3:76078990-76079012 AGTGATGTTGAGCACATGGACGG + Intronic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957534033 3:81477723-81477745 AGTTCTCTTCAGTAAAAGGTAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
958859784 3:99432526-99432548 AGTTCTCTTAAGCACTTGGTAGG + Intergenic
958862911 3:99466702-99466724 AGATATCTTCAGCAACTGGGGGG - Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG + Intergenic
959559054 3:107758643-107758665 AGTACTCTTCAGCACCTGGAGGG + Intronic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
963036783 3:141037223-141037245 TGTTATTTTGAGAACATGGTGGG + Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966306725 3:178544374-178544396 ATTTTTCTAAAGCACATGGTGGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966671601 3:182532583-182532605 AGTTATCTTTATTACATTGTGGG - Intergenic
967773678 3:193362298-193362320 AGTTATCATCAGTGCATTGTTGG - Intronic
969059892 4:4426137-4426159 AGATATTTTCAGAAAATGGTAGG - Intronic
970174909 4:13329892-13329914 AGCTACCTTCAGCACATCTTTGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973130193 4:46639725-46639747 AGTTATATTCAGAACATGGCAGG + Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976933171 4:90593912-90593934 AATTATGTTCAGCTCATAGTAGG + Intronic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
977966856 4:103161777-103161799 TATTCTCTTCAGCACATGATAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
979320027 4:119312644-119312666 TGTCATATTTAGCACATGGTAGG + Intergenic
979348136 4:119613135-119613157 AATTATCTTCAGTTCATGTTTGG - Intronic
980174998 4:129333743-129333765 ACCAATGTTCAGCACATGGTAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982005034 4:151055411-151055433 TGTTTTCCTCAGCACTTGGTGGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984406744 4:179342276-179342298 ATTTGTCCTCAGCACATTGTTGG - Intergenic
985434841 4:189918664-189918686 AGTTATATCCAGCACATGGAGGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988733484 5:33996827-33996849 AGTTAGCTTCAGCTAATGATTGG - Intronic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993319825 5:86458549-86458571 AGTTATCTGCAGAAGATAGTAGG - Intergenic
993325476 5:86529681-86529703 AGTTCTACTCAGAACATGGTGGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993621574 5:90174598-90174620 AGTTTTCTCTAGCACATGGCAGG - Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008739254 6:54585285-54585307 AGTTATTTTCAGTACATTGAGGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1014416983 6:121195361-121195383 GGTTATCTGCAGAAGATGGTAGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020419624 7:7986911-7986933 AATTATCTACTGAACATGGTGGG + Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030409145 7:109153295-109153317 ATTTATCTTCAGCACAGTGAAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032646489 7:133830445-133830467 AGAAATCTTCAACACATAGTAGG + Intronic
1034836936 7:154361284-154361306 GGGTATCTTGAGCAGATGGTGGG - Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1039780672 8:40781920-40781942 AGTTAACTTCTGTATATGGTAGG - Intronic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042149311 8:65765151-65765173 AGTTAACTTCATCCCATGCTAGG - Intronic
1044021829 8:87114239-87114261 ACTTATGTTCAGCAAATGCTGGG - Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045048303 8:98300311-98300333 AGTTAACTTCAGCACAAGGGTGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045575282 8:103414355-103414377 CGTAATCTTCAGCGAATGGTTGG - Intronic
1045656971 8:104397340-104397362 GTTTAGCTTCAGCACATGCTAGG + Intronic
1047596526 8:126383151-126383173 ATTTATCTTCAGGCCATGATGGG + Intergenic
1047883163 8:129218605-129218627 AGTAACCTTCAGCAGATGGATGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051363838 9:16305977-16305999 AGTTTGCTTCACCACATTGTAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1053723902 9:40976727-40976749 AGTTATATCCAGCACATGGAGGG + Intergenic
1054342062 9:63875272-63875294 AGTTATATCCAGCACATGGAGGG - Intergenic
1055531764 9:77191732-77191754 TGTCATCTTGAGAACATGGTTGG + Intronic
1055650584 9:78403205-78403227 AGCTATCTTCTGCAAATGGGAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056102566 9:83313716-83313738 AGTTAAATTCAGCAACTGGTGGG + Exonic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1057001383 9:91513065-91513087 AGTCATCTTCAACAAAGGGTAGG - Intergenic
1057173434 9:92977183-92977205 TGTGCTCTTCAGGACATGGTGGG + Intronic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058549489 9:106098574-106098596 TGTAAACTTCTGCACATGGTGGG + Intergenic
1059745328 9:117194699-117194721 TGTTATCTCCAGCACATGCTTGG + Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1203451264 Un_GL000219v1:119270-119292 AGTTATATCCAGCACACGGAGGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189605028 X:42668046-42668068 AGTTATCCTCAGCACACCATAGG - Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192325319 X:70127136-70127158 AGCACTCTTCATCACATGGTTGG - Intergenic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193242176 X:79183903-79183925 AAATATGTTCAGCGCATGGTTGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195124061 X:101787483-101787505 AGTTATCCTCAGCACACCCTAGG + Intergenic
1195950850 X:110271082-110271104 CTTTATCTACAGCAAATGGTTGG - Intronic
1196103940 X:111876155-111876177 AGGAATTTTCATCACATGGTAGG - Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196235243 X:113272384-113272406 AGTTTTCTACATCACATGGGGGG + Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199303214 X:146236945-146236967 AGCTATATTCAGGACATGGCAGG - Intergenic
1201595313 Y:15661550-15661572 ACTTATCTGCACCAAATGGTTGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic