ID: 954891609

View in Genome Browser
Species Human (GRCh38)
Location 3:53935516-53935538
Sequence CAGTGTGAGTAAATGTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954891608_954891609 -10 Left 954891608 3:53935503-53935525 CCTTGATTTTCAGCAGTGTGAGT No data
Right 954891609 3:53935516-53935538 CAGTGTGAGTAAATGTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954891609 Original CRISPR CAGTGTGAGTAAATGTATGT AGG Intergenic
No off target data available for this crispr