ID: 954891910

View in Genome Browser
Species Human (GRCh38)
Location 3:53938453-53938475
Sequence GCTTAAGGATGTGCAGGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954891910_954891921 13 Left 954891910 3:53938453-53938475 CCCTATCCTGCACATCCTTAAGC No data
Right 954891921 3:53938489-53938511 CCTGCTACTACTTGCCTTAAGGG No data
954891910_954891919 12 Left 954891910 3:53938453-53938475 CCCTATCCTGCACATCCTTAAGC No data
Right 954891919 3:53938488-53938510 CCCTGCTACTACTTGCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954891910 Original CRISPR GCTTAAGGATGTGCAGGATA GGG (reversed) Intergenic
No off target data available for this crispr