ID: 954894372

View in Genome Browser
Species Human (GRCh38)
Location 3:53963450-53963472
Sequence CCTTCAAGGGGGCGGGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954894364_954894372 14 Left 954894364 3:53963413-53963435 CCAGCATCATGAGCACTGCAGTT No data
Right 954894372 3:53963450-53963472 CCTTCAAGGGGGCGGGTGTCAGG No data
954894363_954894372 15 Left 954894363 3:53963412-53963434 CCCAGCATCATGAGCACTGCAGT No data
Right 954894372 3:53963450-53963472 CCTTCAAGGGGGCGGGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954894372 Original CRISPR CCTTCAAGGGGGCGGGTGTC AGG Intergenic
No off target data available for this crispr