ID: 954894372 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:53963450-53963472 |
Sequence | CCTTCAAGGGGGCGGGTGTC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
954894364_954894372 | 14 | Left | 954894364 | 3:53963413-53963435 | CCAGCATCATGAGCACTGCAGTT | No data | ||
Right | 954894372 | 3:53963450-53963472 | CCTTCAAGGGGGCGGGTGTCAGG | No data | ||||
954894363_954894372 | 15 | Left | 954894363 | 3:53963412-53963434 | CCCAGCATCATGAGCACTGCAGT | No data | ||
Right | 954894372 | 3:53963450-53963472 | CCTTCAAGGGGGCGGGTGTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
954894372 | Original CRISPR | CCTTCAAGGGGGCGGGTGTC AGG | Intergenic | ||
No off target data available for this crispr |