ID: 954897618

View in Genome Browser
Species Human (GRCh38)
Location 3:53990153-53990175
Sequence CTACAGCTGTGCTTTATTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954897618_954897625 21 Left 954897618 3:53990153-53990175 CCCCTAATAAAGCACAGCTGTAG No data
Right 954897625 3:53990197-53990219 ACATTTGGAAGCATCGCTGCAGG No data
954897618_954897623 6 Left 954897618 3:53990153-53990175 CCCCTAATAAAGCACAGCTGTAG No data
Right 954897623 3:53990182-53990204 AAACTTGTCCTTTGAACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954897618 Original CRISPR CTACAGCTGTGCTTTATTAG GGG (reversed) Intergenic
No off target data available for this crispr