ID: 954897620

View in Genome Browser
Species Human (GRCh38)
Location 3:53990155-53990177
Sequence GTCTACAGCTGTGCTTTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954897620_954897623 4 Left 954897620 3:53990155-53990177 CCTAATAAAGCACAGCTGTAGAC No data
Right 954897623 3:53990182-53990204 AAACTTGTCCTTTGAACATTTGG No data
954897620_954897625 19 Left 954897620 3:53990155-53990177 CCTAATAAAGCACAGCTGTAGAC No data
Right 954897625 3:53990197-53990219 ACATTTGGAAGCATCGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954897620 Original CRISPR GTCTACAGCTGTGCTTTATT AGG (reversed) Intergenic
No off target data available for this crispr