ID: 954897622

View in Genome Browser
Species Human (GRCh38)
Location 3:53990177-53990199
Sequence TGTTCAAAGGACAAGTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954897622_954897625 -3 Left 954897622 3:53990177-53990199 CCTGGAAACTTGTCCTTTGAACA No data
Right 954897625 3:53990197-53990219 ACATTTGGAAGCATCGCTGCAGG No data
954897622_954897626 25 Left 954897622 3:53990177-53990199 CCTGGAAACTTGTCCTTTGAACA No data
Right 954897626 3:53990225-53990247 TCCTTTGCTTGAGACACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954897622 Original CRISPR TGTTCAAAGGACAAGTTTCC AGG (reversed) Intergenic
No off target data available for this crispr