ID: 954897623

View in Genome Browser
Species Human (GRCh38)
Location 3:53990182-53990204
Sequence AAACTTGTCCTTTGAACATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954897620_954897623 4 Left 954897620 3:53990155-53990177 CCTAATAAAGCACAGCTGTAGAC No data
Right 954897623 3:53990182-53990204 AAACTTGTCCTTTGAACATTTGG No data
954897618_954897623 6 Left 954897618 3:53990153-53990175 CCCCTAATAAAGCACAGCTGTAG No data
Right 954897623 3:53990182-53990204 AAACTTGTCCTTTGAACATTTGG No data
954897617_954897623 7 Left 954897617 3:53990152-53990174 CCCCCTAATAAAGCACAGCTGTA No data
Right 954897623 3:53990182-53990204 AAACTTGTCCTTTGAACATTTGG No data
954897619_954897623 5 Left 954897619 3:53990154-53990176 CCCTAATAAAGCACAGCTGTAGA No data
Right 954897623 3:53990182-53990204 AAACTTGTCCTTTGAACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954897623 Original CRISPR AAACTTGTCCTTTGAACATT TGG Intergenic
No off target data available for this crispr