ID: 954897625

View in Genome Browser
Species Human (GRCh38)
Location 3:53990197-53990219
Sequence ACATTTGGAAGCATCGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954897620_954897625 19 Left 954897620 3:53990155-53990177 CCTAATAAAGCACAGCTGTAGAC No data
Right 954897625 3:53990197-53990219 ACATTTGGAAGCATCGCTGCAGG No data
954897622_954897625 -3 Left 954897622 3:53990177-53990199 CCTGGAAACTTGTCCTTTGAACA No data
Right 954897625 3:53990197-53990219 ACATTTGGAAGCATCGCTGCAGG No data
954897619_954897625 20 Left 954897619 3:53990154-53990176 CCCTAATAAAGCACAGCTGTAGA No data
Right 954897625 3:53990197-53990219 ACATTTGGAAGCATCGCTGCAGG No data
954897618_954897625 21 Left 954897618 3:53990153-53990175 CCCCTAATAAAGCACAGCTGTAG No data
Right 954897625 3:53990197-53990219 ACATTTGGAAGCATCGCTGCAGG No data
954897617_954897625 22 Left 954897617 3:53990152-53990174 CCCCCTAATAAAGCACAGCTGTA No data
Right 954897625 3:53990197-53990219 ACATTTGGAAGCATCGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954897625 Original CRISPR ACATTTGGAAGCATCGCTGC AGG Intergenic
No off target data available for this crispr