ID: 954898378

View in Genome Browser
Species Human (GRCh38)
Location 3:53996860-53996882
Sequence CAGTCACTGCTGAGGGACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954898378_954898385 16 Left 954898378 3:53996860-53996882 CCAGCGTCCCTCAGCAGTGACTG No data
Right 954898385 3:53996899-53996921 GAACAAGAGCCAGTGAATTTGGG No data
954898378_954898384 15 Left 954898378 3:53996860-53996882 CCAGCGTCCCTCAGCAGTGACTG No data
Right 954898384 3:53996898-53996920 GGAACAAGAGCCAGTGAATTTGG No data
954898378_954898383 -6 Left 954898378 3:53996860-53996882 CCAGCGTCCCTCAGCAGTGACTG No data
Right 954898383 3:53996877-53996899 TGACTGGATAGGACTTTCAGTGG No data
954898378_954898386 17 Left 954898378 3:53996860-53996882 CCAGCGTCCCTCAGCAGTGACTG No data
Right 954898386 3:53996900-53996922 AACAAGAGCCAGTGAATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954898378 Original CRISPR CAGTCACTGCTGAGGGACGC TGG (reversed) Intergenic
No off target data available for this crispr