ID: 954900498

View in Genome Browser
Species Human (GRCh38)
Location 3:54015012-54015034
Sequence CTGGAGCCACAGCTGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954900490_954900498 4 Left 954900490 3:54014985-54015007 CCTCTTAAGAATTCCCATGTAGG No data
Right 954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG No data
954900484_954900498 25 Left 954900484 3:54014964-54014986 CCTCACCTGGCCCTGGGCGCCCC No data
Right 954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG No data
954900494_954900498 -9 Left 954900494 3:54014998-54015020 CCCATGTAGGGATTCTGGAGCCA No data
Right 954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG No data
954900483_954900498 28 Left 954900483 3:54014961-54014983 CCACCTCACCTGGCCCTGGGCGC No data
Right 954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG No data
954900495_954900498 -10 Left 954900495 3:54014999-54015021 CCATGTAGGGATTCTGGAGCCAC No data
Right 954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG No data
954900485_954900498 20 Left 954900485 3:54014969-54014991 CCTGGCCCTGGGCGCCCCTCTTA No data
Right 954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG No data
954900488_954900498 6 Left 954900488 3:54014983-54015005 CCCCTCTTAAGAATTCCCATGTA No data
Right 954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG No data
954900489_954900498 5 Left 954900489 3:54014984-54015006 CCCTCTTAAGAATTCCCATGTAG No data
Right 954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG No data
954900487_954900498 14 Left 954900487 3:54014975-54014997 CCTGGGCGCCCCTCTTAAGAATT No data
Right 954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG No data
954900486_954900498 15 Left 954900486 3:54014974-54014996 CCCTGGGCGCCCCTCTTAAGAAT No data
Right 954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954900498 Original CRISPR CTGGAGCCACAGCTGGAAGG TGG Intergenic
No off target data available for this crispr