ID: 954906510

View in Genome Browser
Species Human (GRCh38)
Location 3:54067738-54067760
Sequence CCCTCTGGGCAGAGGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954906510_954906523 7 Left 954906510 3:54067738-54067760 CCTGGCCCCCTCTGCCCAGAGGG No data
Right 954906523 3:54067768-54067790 GGAATTATACCCCATGTCATGGG No data
954906510_954906529 18 Left 954906510 3:54067738-54067760 CCTGGCCCCCTCTGCCCAGAGGG No data
Right 954906529 3:54067779-54067801 CCATGTCATGGGGGATGTTAAGG No data
954906510_954906524 8 Left 954906510 3:54067738-54067760 CCTGGCCCCCTCTGCCCAGAGGG No data
Right 954906524 3:54067769-54067791 GAATTATACCCCATGTCATGGGG No data
954906510_954906525 9 Left 954906510 3:54067738-54067760 CCTGGCCCCCTCTGCCCAGAGGG No data
Right 954906525 3:54067770-54067792 AATTATACCCCATGTCATGGGGG No data
954906510_954906530 24 Left 954906510 3:54067738-54067760 CCTGGCCCCCTCTGCCCAGAGGG No data
Right 954906530 3:54067785-54067807 CATGGGGGATGTTAAGGAGCTGG No data
954906510_954906522 6 Left 954906510 3:54067738-54067760 CCTGGCCCCCTCTGCCCAGAGGG No data
Right 954906522 3:54067767-54067789 TGGAATTATACCCCATGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954906510 Original CRISPR CCCTCTGGGCAGAGGGGGCC AGG (reversed) Intergenic
No off target data available for this crispr