ID: 954911460

View in Genome Browser
Species Human (GRCh38)
Location 3:54114263-54114285
Sequence AACTCCAAGGAGAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954911455_954911460 9 Left 954911455 3:54114231-54114253 CCGAGGTGGGATCAAGCTTGGCT No data
Right 954911460 3:54114263-54114285 AACTCCAAGGAGAAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954911460 Original CRISPR AACTCCAAGGAGAAGGAGGC TGG Intergenic
No off target data available for this crispr