ID: 954912491

View in Genome Browser
Species Human (GRCh38)
Location 3:54121728-54121750
Sequence CGCGCCCGACCCAGGCCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 201}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954912491_954912499 -2 Left 954912491 3:54121728-54121750 CCCCGGGGCCTGGGTCGGGCGCG 0: 1
1: 0
2: 2
3: 19
4: 201
Right 954912499 3:54121749-54121771 CGCAGGGGGCCGCTGCGCTGCGG 0: 1
1: 0
2: 1
3: 11
4: 191
954912491_954912502 9 Left 954912491 3:54121728-54121750 CCCCGGGGCCTGGGTCGGGCGCG 0: 1
1: 0
2: 2
3: 19
4: 201
Right 954912502 3:54121760-54121782 GCTGCGCTGCGGCCGGATGCCGG 0: 1
1: 0
2: 3
3: 10
4: 100
954912491_954912503 10 Left 954912491 3:54121728-54121750 CCCCGGGGCCTGGGTCGGGCGCG 0: 1
1: 0
2: 2
3: 19
4: 201
Right 954912503 3:54121761-54121783 CTGCGCTGCGGCCGGATGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 113
954912491_954912505 23 Left 954912491 3:54121728-54121750 CCCCGGGGCCTGGGTCGGGCGCG 0: 1
1: 0
2: 2
3: 19
4: 201
Right 954912505 3:54121774-54121796 GGATGCCGGGAGCCCCGCGCTGG 0: 1
1: 0
2: 2
3: 24
4: 201
954912491_954912500 2 Left 954912491 3:54121728-54121750 CCCCGGGGCCTGGGTCGGGCGCG 0: 1
1: 0
2: 2
3: 19
4: 201
Right 954912500 3:54121753-54121775 GGGGGCCGCTGCGCTGCGGCCGG 0: 1
1: 0
2: 4
3: 32
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954912491 Original CRISPR CGCGCCCGACCCAGGCCCCG GGG (reversed) Intergenic
900283906 1:1890487-1890509 CCCGCCCGACCCGCGCCCCCGGG + Intronic
900363367 1:2300506-2300528 CCCGCCCTACCAAGGCCCCTGGG - Intronic
900401631 1:2475180-2475202 CACGCCTGACCTTGGCCCCGGGG + Intronic
900427450 1:2587030-2587052 CCAGCCCCGCCCAGGCCCCGCGG - Intronic
900526689 1:3132795-3132817 CCTGCCCCACCCAGTCCCCGGGG - Intronic
900622398 1:3593432-3593454 CCCGCCCCACCCAGGACCCCAGG + Intronic
901017938 1:6242378-6242400 CGCGCCCGCCCCCGCCCCCTCGG - Intergenic
901381603 1:8878391-8878413 CGCCCCCGCCCCGGGCCTCGGGG + Intronic
903193519 1:21669253-21669275 CGCCCCCGGCCCAGGCCCTTGGG - Intronic
903909142 1:26709483-26709505 CACCCCCGACCCAGGACCCCAGG + Intronic
904091046 1:27945326-27945348 AGTGCCCGACGCAGGCCCCTGGG + Exonic
905670682 1:39788536-39788558 CGCGGCCGACCCAGGGCCTGGGG + Exonic
907300941 1:53485931-53485953 CCGGCCCCACCCATGCCCCGTGG + Intergenic
907767369 1:57424161-57424183 CGCGCCCGCCCGGCGCCCCGCGG + Intronic
910936142 1:92485574-92485596 CGCGCTCGGCCCAGGCCCCGGGG - Intronic
913486565 1:119337099-119337121 CCCTCCCCACCCAAGCCCCGTGG + Intergenic
917291594 1:173477214-173477236 CGCGCCCAGCCCAGCCCCCGCGG + Intergenic
918048291 1:180954213-180954235 CCCGCCCGCGCGAGGCCCCGCGG - Intergenic
918282968 1:183023591-183023613 CGCGCCGGAGTCAGGCCCCTGGG + Exonic
920805706 1:209231810-209231832 AGCCCGCGACCCCGGCCCCGCGG - Intergenic
922851364 1:228736014-228736036 CGCCCCCGGCCCCGGCCCCCCGG - Intronic
923500457 1:234559793-234559815 CGAGCCAGAGCCAGGCCCCCGGG + Intergenic
924527117 1:244863201-244863223 CGCGCCCGCCCCGGGACCTGGGG + Intronic
1064059943 10:12129340-12129362 CACGTCCGACCCAGGCCTCCTGG - Intergenic
1064354355 10:14604152-14604174 CCTGCCCGACCCCGGCTCCGGGG - Intronic
1065092943 10:22252829-22252851 GGCGCCTGGCCCAGGCCCCCAGG + Intergenic
1065712816 10:28533461-28533483 CGCGCCGGGCCCAGGTGCCGGGG + Exonic
1066221169 10:33336699-33336721 CGCGCCCAGCGCAGACCCCGGGG + Intergenic
1070129698 10:73647845-73647867 GGCGCCTGCCCCAGGCCCAGGGG - Exonic
1070767889 10:79067150-79067172 TCGGCCCGCCCCAGGCCCCGGGG + Intergenic
1072654675 10:97321355-97321377 AGCCCCCAACCCAGGCCCCCAGG - Exonic
1072994281 10:100229500-100229522 CGCGCCCGGCCGCAGCCCCGGGG + Exonic
1073181912 10:101588466-101588488 CTCTGCCGACCCAGGCCCTGAGG - Intronic
1076512851 10:131024794-131024816 CGCCCCCGGCCCAGGCCCCCAGG - Intergenic
1076792598 10:132785198-132785220 AGCGCCAGCCCCGGGCCCCGCGG - Intronic
1076908213 10:133373599-133373621 CGCCCCCGCCCCAGCCCTCGGGG + Exonic
1076916348 10:133424584-133424606 CGCGCAAAACCCAGGCGCCGCGG - Intergenic
1076936455 10:133569379-133569401 CGCGCAAAACCCAGGCGCCGCGG - Intronic
1077043720 11:535435-535457 CGGCCCCGGCCCTGGCCCCGGGG - Exonic
1077093954 11:791580-791602 CCTGCCCGGCCCAGGCCCGGGGG + Exonic
1077179619 11:1206548-1206570 CGGCCCCGACACAGGCCCAGCGG + Intergenic
1077530029 11:3090736-3090758 CGCCCCCTGCCCAGGCCCCAGGG + Intronic
1083691299 11:64410434-64410456 CTCCCCCGACCCCGGCCCCATGG - Intergenic
1084758346 11:71252650-71252672 CGCGTGCGGCCCAGGACCCGCGG + Intergenic
1089254392 11:117186643-117186665 CCCGCCCCACCCAGGCCCCCTGG - Intronic
1091327731 11:134703787-134703809 TGCGCCTAACCCAGGCCCCCCGG - Intergenic
1096226254 12:49868585-49868607 CGGCCCCCACCCAGGCCCAGGGG + Exonic
1096791411 12:54047429-54047451 CGCCCCGGACCCAGGCCGCGAGG + Intronic
1101482154 12:105108145-105108167 CGCGCCCCGCCCAAGCCCCGGGG - Intronic
1102068611 12:109999468-109999490 CGCGCCCACCCCGCGCCCCGCGG - Intronic
1103764405 12:123270933-123270955 CGCTCCCGGCCGAGGCCCCCGGG + Intronic
1104808258 12:131603329-131603351 AGTACCTGACCCAGGCCCCGAGG - Intergenic
1113964930 13:114147569-114147591 CACAACCGACCCAGCCCCCGAGG + Intergenic
1113964982 13:114147714-114147736 CACAACCGACCCAGCCCCCGAGG + Intergenic
1113965013 13:114147801-114147823 CACAACCGACCCAGCCCCCGAGG + Intergenic
1113965023 13:114147830-114147852 CACAACCGACCCAGCCCCCGAGG + Intergenic
1113965044 13:114147888-114147910 CACAACCGACCCAGCCCCCGAGG + Intergenic
1113965241 13:114149175-114149197 CACAACCGACCCAGCCCCCGTGG - Intergenic
1115331347 14:32201770-32201792 CGCGTGGGACCCAGGCCCCGGGG - Intergenic
1117028990 14:51651018-51651040 CGCCCCCTCCCCAGACCCCGAGG + Intronic
1121052404 14:90828145-90828167 CGCGCCGGCCCCAGTCCCCATGG - Intergenic
1121453903 14:94026619-94026641 CGCGTCCGACCCCCGTCCCGCGG - Intronic
1122162268 14:99793235-99793257 CCCTCCCGGCCCGGGCCCCGCGG + Intronic
1122271196 14:100569061-100569083 CGAGCCTGGCCGAGGCCCCGGGG - Intronic
1122286307 14:100654833-100654855 CCCGCCCGACCCTGCCCCCCGGG + Intergenic
1124999459 15:34755102-34755124 CGCGCGCGTCCCCGGCCCCTCGG - Intergenic
1125535895 15:40441119-40441141 CCCGCCCGGCCCCGGCCCCCAGG + Intronic
1127606565 15:60592677-60592699 CGCGCCCCGCCCCGCCCCCGCGG + Intronic
1128454978 15:67827168-67827190 CGGGCCCGCCCCTGCCCCCGGGG - Intronic
1129483213 15:75843851-75843873 GGCGCCCGGCCGCGGCCCCGCGG + Intronic
1129754719 15:78090987-78091009 CGCTCCCCACCCAGTCCCCAAGG + Intronic
1132475943 16:138272-138294 CGCCCCCGGCCCCGGCCCCACGG - Exonic
1132544668 16:527764-527786 AGCGCCCGGCCCGGGCCCCGCGG - Intronic
1132604014 16:786099-786121 CACCCCCGACCCTGACCCCGAGG - Exonic
1132604507 16:788177-788199 CGCGCCCCGCACAGGCCCGGTGG + Intronic
1132779350 16:1614310-1614332 CGGCCCCGGCCCCGGCCCCGGGG - Intronic
1132843462 16:1989755-1989777 CGAGCCCCACCCTGCCCCCGGGG + Intronic
1132847769 16:2008430-2008452 GGAGGCCGACCCAGACCCCGGGG - Intronic
1136365190 16:29806436-29806458 CGCCCCCGGCCCCGGCCCCGCGG + Intronic
1136927516 16:34388601-34388623 CCCGCCCGTCCCTGGCCACGAGG - Intergenic
1136977058 16:35023205-35023227 CCCGCCCGTCCCTGGCCACGAGG + Exonic
1137683214 16:50368803-50368825 CGCGCCAGGCCCAGGCCGTGCGG + Intronic
1141499842 16:84436418-84436440 CACGCCCGGTCCAGGCCCTGGGG - Intronic
1141957707 16:87383624-87383646 CGAGCCGGACACAGACCCCGAGG - Exonic
1142146413 16:88494667-88494689 CGCCCCCCACTCAGGCCCTGCGG - Intronic
1142638265 17:1270927-1270949 CGCGCCAGCCCCGCGCCCCGCGG + Exonic
1144888974 17:18483205-18483227 CCCACCCATCCCAGGCCCCGTGG - Intronic
1145143234 17:20461091-20461113 CCCACCCATCCCAGGCCCCGTGG + Intronic
1145750176 17:27349601-27349623 CGCCCCCGCCCCAGGCCGCGAGG + Intergenic
1147139717 17:38454148-38454170 CGGCCCCGGCCCCGGCCCCGCGG - Intronic
1147856456 17:43484073-43484095 CGGGTCGGAGCCAGGCCCCGCGG + Exonic
1148135608 17:45289901-45289923 CCGGCCCTACCCAGGCCTCGTGG + Intronic
1148151094 17:45396767-45396789 CGCGCCCGCCCTGGGCCCCGTGG - Exonic
1151426976 17:74037362-74037384 CGAGCCCTGCCCAGGCCCCTGGG - Intergenic
1151703337 17:75754519-75754541 TGCCCCAGACCCGGGCCCCGTGG - Intronic
1152729379 17:81962018-81962040 CGCGCCCCAGCAAGGCGCCGCGG + Intergenic
1152800867 17:82330096-82330118 GGAGCCGGACCCAGGCCCCCTGG - Intronic
1154202462 18:12308603-12308625 CGCGCCCACCCCAGGCGCCCCGG - Intronic
1157047329 18:44118073-44118095 CCCCCCCAACCCAGGCCCAGTGG - Intergenic
1157752934 18:50194720-50194742 AGCGCGCCACCCCGGCCCCGGGG + Intronic
1160592169 18:79951098-79951120 CGCGCCAGCCGCAGGACCCGAGG + Intronic
1160668389 19:344394-344416 CGGCCCCGGCCCGGGCCCCGCGG - Intronic
1160696049 19:484974-484996 AGCCCCCAGCCCAGGCCCCGTGG - Intergenic
1160930801 19:1568606-1568628 CTCGCGCGCCCCAGGGCCCGAGG + Intergenic
1160961880 19:1725777-1725799 CCCGCCCGACCCCGCCCCCCCGG + Intergenic
1161396623 19:4047967-4047989 GGCGCCCGACCCCAGCCCGGGGG - Exonic
1161620067 19:5293053-5293075 CGCGCCCCCTCCAGGCTCCGAGG - Intronic
1162100399 19:8335358-8335380 CGCGCCCAGCCCCGGCCGCGGGG - Exonic
1162951321 19:14073466-14073488 CGCGCCCGCTCCAGGGCGCGCGG - Exonic
1163437321 19:17303253-17303275 CCGCCCCGACCCGGGCCCCGCGG - Exonic
1163685885 19:18711369-18711391 CCCGCCCGGCCCAGGCACAGAGG - Intronic
1163715246 19:18869353-18869375 CGCGGCCGAGGCAGGCTCCGAGG + Exonic
1163799654 19:19356783-19356805 CGCACCCTAGCCAGGCCCCAGGG + Exonic
1165349743 19:35269198-35269220 CGGCCCCGGCCCCGGCCCCGCGG + Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1165859556 19:38900124-38900146 CGCGCCCAACCCAGGTCCTCCGG - Exonic
1166344332 19:42155976-42155998 CGCGCCCCACCCCCACCCCGTGG - Intronic
1166753732 19:45178134-45178156 CGACCCCGACCCCGGCCCGGGGG - Exonic
1167268244 19:48493866-48493888 CGCGCCCTCCCGGGGCCCCGCGG + Exonic
1167368079 19:49065064-49065086 CGCCCCCGACCCGGGCCCTGCGG - Intronic
1167578460 19:50328887-50328909 CGCGCCGGTCCCCGGGCCCGCGG + Exonic
1167622599 19:50567910-50567932 CGCCCCCGACCCGTGCCCCTTGG + Intronic
927667452 2:25042333-25042355 CGCGCCCGGGCCCGGGCCCGCGG + Intronic
937249043 2:120511778-120511800 CGCGAGGGACCCAGGGCCCGGGG + Intergenic
937308301 2:120885565-120885587 CTGCCCCGCCCCAGGCCCCGAGG - Intronic
942278241 2:174337650-174337672 CGCGCCCAGCCCGGGCCCTGGGG - Exonic
944221655 2:197310207-197310229 CGCCGCCGGCCCGGGCCCCGGGG - Intronic
948518952 2:238523668-238523690 CGCGCCCGTCCCTGGTCCCGCGG + Intergenic
1169074403 20:2752246-2752268 CGCACCCGGCTCGGGCCCCGGGG - Exonic
1169084992 20:2821007-2821029 CGCGCTAGACCAAGGCCCGGGGG + Intergenic
1170125744 20:12961566-12961588 CCCTCCAGACCCACGCCCCGTGG - Intergenic
1170889615 20:20367140-20367162 GGGGCCCGACCCAGGCCGCCCGG - Intergenic
1172109363 20:32536354-32536376 CGGGCCCCACCCAGGGCCGGGGG + Intronic
1172118423 20:32584512-32584534 CCCGCCTGCCCCAAGCCCCGCGG + Intronic
1175823972 20:61926583-61926605 TGAGCCCGGGCCAGGCCCCGTGG + Intronic
1176223189 20:63979576-63979598 CGCGCCCGAGCCGGTCCCCGCGG + Exonic
1179957394 21:44749259-44749281 CAGGCCCGACCCAGGCCTCCAGG - Intergenic
1180014766 21:45074811-45074833 CGCGCCCGCCCGAGCCGCCGCGG - Intronic
1180059463 21:45377135-45377157 GGGGCCCTACCCAGACCCCGGGG + Intergenic
1180791412 22:18577492-18577514 CGCGCCAGGCCCAGGCGGCGCGG - Intergenic
1180950561 22:19718787-19718809 CGCCGCGGACCCAGGCCCAGAGG + Intronic
1181000725 22:19986817-19986839 CCCGACCCCCCCAGGCCCCGCGG + Intronic
1181165156 22:20979374-20979396 CGCCCCCATCCGAGGCCCCGGGG - Intronic
1181230327 22:21417819-21417841 CGCGCCAGGCCCAGGCGGCGCGG + Intronic
1181248323 22:21517044-21517066 CGCGCCAGGCCCAGGCGGCGCGG - Intergenic
1183376500 22:37468347-37468369 CTCCCCCAACCCAGGCCCTGGGG + Intergenic
1184620466 22:45672366-45672388 GGCGCCCGCCCCAGGCCCCGCGG - Intronic
1184647178 22:45902753-45902775 CGCTCCCGACCGTGGCACCGTGG - Intergenic
1184746964 22:46461821-46461843 CGCCCCCCACCCAGGCCACATGG + Intronic
1184785312 22:46668741-46668763 CGCCCCCCACCCCGGCCCTGCGG + Intronic
1185250425 22:49798927-49798949 AGCGTCCCACCCACGCCCCGTGG + Intronic
1185301094 22:50081607-50081629 CACCCCCGACTCAGGGCCCGGGG - Intronic
954217763 3:49133829-49133851 CGCGCCCCACCCAGGGCCCTGGG + Intergenic
954316221 3:49803204-49803226 CGCGCCCCGCCCCGGCCCCGCGG - Intergenic
954415040 3:50389146-50389168 CGCCCCCGCCCCAGGCCCACCGG - Intronic
954912491 3:54121728-54121750 CGCGCCCGACCCAGGCCCCGGGG - Intergenic
955911631 3:63864107-63864129 CCCGCCCGGCCCACGCCCAGAGG + Intergenic
961551638 3:127673135-127673157 GCCGCCCGTCCCAGGGCCCGAGG - Intronic
961827532 3:129606768-129606790 CGCCCCCGACCCCGGCGCCCGGG + Exonic
962350200 3:134650796-134650818 CGCGCCCGACCCGGGTCCCCGGG - Intronic
968541638 4:1171211-1171233 CGCGCCTGGCCCCGGCCCCCCGG + Intronic
968878713 4:3287867-3287889 GGGCCCCCACCCAGGCCCCGTGG - Intergenic
968956382 4:3721838-3721860 TGCGTCAGACCCAGGCCCTGTGG + Intergenic
969059330 4:4422653-4422675 CACGCCCCTCCCAGGCCCCCTGG + Intronic
969115363 4:4867581-4867603 CGCCCCCTTCCCAGGCCCAGGGG + Intergenic
972396792 4:38664555-38664577 CACCCCCGACCCATTCCCCGCGG - Intronic
978503656 4:109434148-109434170 CGCACCCAACCCGGACCCCGCGG - Intronic
981128410 4:141132634-141132656 CGCGCCGGACCCCGGGGCCGGGG - Exonic
983940099 4:173529003-173529025 CGCGGCCCCCCCAGGCCCGGGGG + Exonic
990165470 5:52989217-52989239 CCCGCCCCACCCCGGCCCTGCGG - Intergenic
990308683 5:54518132-54518154 CGCCCCCGAGCCTGGCCCGGCGG + Exonic
992042427 5:72848685-72848707 CGCCCCCGGCCCAGGCACCAGGG - Intronic
996811202 5:127517841-127517863 GGCGCCAGAGCCAGACCCCGAGG + Intronic
997367266 5:133333982-133334004 CAGGCCCCACCCAGGTCCCGAGG + Intronic
999202267 5:149824801-149824823 TGGGCCTGACCCAGGCCCTGGGG - Intronic
1002633604 5:180596484-180596506 GGCGCTGGACCCCGGCCCCGAGG + Intergenic
1002925737 6:1604891-1604913 CGGCCCCGGCCCAGGCCCCCGGG + Intergenic
1002925800 6:1605085-1605107 CGCAGCGGACCCAGGCGCCGGGG - Intergenic
1003175936 6:3752122-3752144 CGCGCCCCACCCGGCCCGCGAGG + Intergenic
1003290734 6:4776478-4776500 CGCGCCCGCCCCAGCCCGCCCGG + Exonic
1006512129 6:34527178-34527200 CGCCCCCGCCCCCCGCCCCGCGG - Intronic
1007625384 6:43243620-43243642 CCCGCCCCGCCCCGGCCCCGGGG + Intergenic
1013300294 6:108798902-108798924 CTCCCCCAACCCAGGCCCCTAGG - Intergenic
1014477247 6:121888750-121888772 CACGCCCGCCCCATGCCCTGTGG + Intergenic
1015244556 6:131062675-131062697 CGCGGCCGACCCCCTCCCCGCGG + Intronic
1016340890 6:143060752-143060774 CGCGGCCGCGCCAGTCCCCGGGG + Intronic
1017163832 6:151390449-151390471 CGCGCTCGCCCCAAGTCCCGCGG + Intronic
1018726064 6:166614402-166614424 CGCTTCCTACCCAGGCCCCGAGG + Intronic
1019428589 7:988428-988450 GCCGCCCCACCCCGGCCCCGAGG - Intronic
1019501504 7:1367062-1367084 GGCTGCAGACCCAGGCCCCGAGG - Intergenic
1019563952 7:1670588-1670610 CGACCCCGACCCGGGCCCCCGGG - Intergenic
1019740678 7:2671434-2671456 AGCCCCCAACCCAGGCCCAGGGG - Intergenic
1019764973 7:2843689-2843711 CCCCCCCGACCCATTCCCCGAGG - Intronic
1019828149 7:3301019-3301041 GCCGCCCGAGCCAGGCGCCGCGG + Intergenic
1029122930 7:98280871-98280893 GGCGCCTGACGCAGTCCCCGAGG + Intronic
1029270476 7:99374431-99374453 TGCGCCCGGCCCAGGCTCGGAGG + Intronic
1029363094 7:100101090-100101112 CGCACGCTTCCCAGGCCCCGTGG + Intronic
1031483656 7:122305204-122305226 CCCGGCCCACCCAGGCCCAGTGG - Intronic
1034979578 7:155467369-155467391 CCTGCCCGACCCAGGGTCCGGGG - Intergenic
1037844986 8:22275321-22275343 CGAGCTCAACCCACGCCCCGGGG - Exonic
1037882423 8:22579559-22579581 CGCCCCCACCCCAGTCCCCGAGG - Intronic
1039996843 8:42541627-42541649 CGCGCCCGGCCCCGACTCCGGGG + Intronic
1040600410 8:48878304-48878326 CACGCCCTCCCCAGGCCCCTAGG - Intergenic
1045305417 8:100952700-100952722 CGCGCCCTGCCCCCGCCCCGGGG - Intronic
1047998651 8:130358801-130358823 CGCTCCCGACCCCGGCTGCGCGG + Intronic
1048886635 8:138914478-138914500 CGCCCCCTCCCCAGGCCCCCTGG - Intergenic
1049381804 8:142319901-142319923 CGGCCCTGACCAAGGCCCCGGGG - Intronic
1049879507 8:145052383-145052405 CGCGCCCCGCCCGCGCCCCGCGG + Exonic
1053149135 9:35732013-35732035 CGCCCCGGGGCCAGGCCCCGCGG + Intronic
1053409033 9:37903892-37903914 CGGGCCCCACCCAGGCGGCGCGG - Exonic
1054973939 9:71120987-71121009 CGCCCCCCACCCACACCCCGTGG - Intronic
1057311510 9:93946071-93946093 CGCTGCCGCCCCAGCCCCCGCGG - Intergenic
1060087251 9:120714122-120714144 CTCCCACGGCCCAGGCCCCGAGG - Exonic
1060549004 9:124476490-124476512 CCGGCCCTACCCAGGCCCTGTGG - Intronic
1061052425 9:128204315-128204337 CGCCCCCCACCCAGGGGCCGTGG - Intronic
1061348091 9:130042879-130042901 CGCCCCCTCCCCAGGCCGCGGGG + Intronic
1061559723 9:131394460-131394482 CCCGCCGCCCCCAGGCCCCGCGG - Intronic
1061574356 9:131496847-131496869 CAGGCCCATCCCAGGCCCCGTGG + Exonic
1061843825 9:133375870-133375892 CGGTCCCGACCCAGGCCGCCCGG - Intronic
1062330915 9:136044603-136044625 CGCCCCCGTCCCAGGCCACAAGG + Intronic
1062362394 9:136193977-136193999 AGCGCCCGTCCCTGGCCGCGGGG + Intergenic
1189821633 X:44874037-44874059 CGCGCTCGCCCCGGGCCCCGCGG + Intronic
1200217506 X:154374571-154374593 CGCGCCCGCGCCAGGCGCCTCGG + Exonic