ID: 954913000

View in Genome Browser
Species Human (GRCh38)
Location 3:54123792-54123814
Sequence GAGTATCCTGCTTTTCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 244}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954913000_954913003 -2 Left 954913000 3:54123792-54123814 CCACAAAGAAAAGCAGGATACTC 0: 1
1: 0
2: 0
3: 13
4: 244
Right 954913003 3:54123813-54123835 TCACTCGCACTGTCCTGGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 95
954913000_954913001 -7 Left 954913000 3:54123792-54123814 CCACAAAGAAAAGCAGGATACTC 0: 1
1: 0
2: 0
3: 13
4: 244
Right 954913001 3:54123808-54123830 GATACTCACTCGCACTGTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 56
954913000_954913002 -3 Left 954913000 3:54123792-54123814 CCACAAAGAAAAGCAGGATACTC 0: 1
1: 0
2: 0
3: 13
4: 244
Right 954913002 3:54123812-54123834 CTCACTCGCACTGTCCTGGCTGG 0: 1
1: 0
2: 1
3: 22
4: 224
954913000_954913004 -1 Left 954913000 3:54123792-54123814 CCACAAAGAAAAGCAGGATACTC 0: 1
1: 0
2: 0
3: 13
4: 244
Right 954913004 3:54123814-54123836 CACTCGCACTGTCCTGGCTGGGG 0: 1
1: 0
2: 1
3: 17
4: 149
954913000_954913005 4 Left 954913000 3:54123792-54123814 CCACAAAGAAAAGCAGGATACTC 0: 1
1: 0
2: 0
3: 13
4: 244
Right 954913005 3:54123819-54123841 GCACTGTCCTGGCTGGGGCTCGG 0: 1
1: 1
2: 2
3: 54
4: 429
954913000_954913007 25 Left 954913000 3:54123792-54123814 CCACAAAGAAAAGCAGGATACTC 0: 1
1: 0
2: 0
3: 13
4: 244
Right 954913007 3:54123840-54123862 GGAAACTGAGTGTTTTTGCATGG 0: 1
1: 0
2: 5
3: 18
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954913000 Original CRISPR GAGTATCCTGCTTTTCTTTG TGG (reversed) Intronic
903149999 1:21400421-21400443 GAGTGGCATGCTTTTCTTTAAGG + Intergenic
905501843 1:38445790-38445812 GATTATCCTTCTGGTCTTTGGGG + Intergenic
907651814 1:56302501-56302523 GAGTATGATGCTATTCCTTGTGG - Intergenic
908238341 1:62168541-62168563 GAGTATGTTTCTTTTCTTTTTGG - Intergenic
908714812 1:67058221-67058243 AGGTATCCTGTTTTTCATTGAGG + Intergenic
909102281 1:71363625-71363647 GAGTAATGTGCTTTTCTTTTTGG - Intergenic
909407593 1:75309530-75309552 GTATTTACTGCTTTTCTTTGAGG - Intronic
910383868 1:86660480-86660502 ATCTTTCCTGCTTTTCTTTGTGG - Intergenic
912688089 1:111782736-111782758 GATTCTCCTGTTCTTCTTTGTGG + Intronic
913447222 1:118962407-118962429 AAGTAGCCTGCTTTACTTTTGGG - Intronic
914850764 1:151312324-151312346 CAGTCTCTTGCTTTTCTTTTAGG - Intronic
915759338 1:158295196-158295218 GAGTATACTGCTCTTCTTGATGG - Intergenic
916196313 1:162226588-162226610 GAGTAACCTGATTTAATTTGGGG + Intronic
918064071 1:181088082-181088104 TAGAATCCCCCTTTTCTTTGGGG + Intergenic
918600986 1:186361113-186361135 GGGTTTCCTTATTTTCTTTGTGG - Intronic
918879045 1:190090174-190090196 GACAATCCTCCTTTACTTTGAGG - Intergenic
919298990 1:195737307-195737329 GAATGGCCTGCTTTTCTTTAAGG + Intergenic
920431921 1:205924155-205924177 GAGTATGCTGGCTTTCTCTGGGG + Intronic
921621610 1:217331727-217331749 GAGTGTTCTCTTTTTCTTTGTGG - Intergenic
1063984036 10:11482110-11482132 AACTTTCCTGCTTTTCTCTGTGG - Intronic
1064726569 10:18286178-18286200 GAGTATACAGATATTCTTTGTGG - Intronic
1064946556 10:20796786-20796808 GACAATCCTGCTTATATTTGTGG - Intronic
1065405021 10:25354401-25354423 TAGTTTGCTTCTTTTCTTTGTGG - Intronic
1065940289 10:30558232-30558254 GAGTTTCATCCTTTTCTCTGTGG - Intergenic
1066584861 10:36921502-36921524 GCCTATCCTACTTTTATTTGAGG - Intergenic
1068220880 10:54044046-54044068 GCATATCCTGCTGTTCTTTTTGG - Intronic
1069073375 10:64013116-64013138 GATAATTCTTCTTTTCTTTGGGG + Intergenic
1070374290 10:75814152-75814174 GAAGATCCTGCTTTTCTGTCTGG + Intronic
1071053397 10:81478976-81478998 GAGTATCTTGATTTTGTTGGTGG + Intergenic
1072158963 10:92748715-92748737 GATTATCTTGATATTCTTTGTGG + Intergenic
1072403493 10:95128492-95128514 GAGCTTCCTGCTTTTCACTGTGG + Intergenic
1073122299 10:101130231-101130253 GAGTTTCCTCCTTTTCTCTTGGG + Intronic
1078118103 11:8476132-8476154 CAGAATCCTGATCTTCTTTGGGG + Intronic
1078688287 11:13553170-13553192 GGGTATTCTGTTTTTCTTTTTGG + Intergenic
1082616605 11:55368603-55368625 CACTATCCTGCTTTCCTATGGGG + Exonic
1082700445 11:56423406-56423428 GAGTATCTTTGTTTTATTTGTGG - Intergenic
1082852641 11:57779027-57779049 GTGTGTGCTGCTATTCTTTGTGG + Intronic
1083259845 11:61517013-61517035 GAGTCCCCTTCTTCTCTTTGGGG + Intronic
1084155911 11:67312342-67312364 GAGGATCCTGCCTGCCTTTGGGG - Exonic
1084941806 11:72617076-72617098 CAGAGTCCTGCTTGTCTTTGGGG + Intronic
1087050030 11:93877442-93877464 GAGAAACCTGTTTTTCTTTATGG - Intergenic
1087051608 11:93891187-93891209 TATTTTCTTGCTTTTCTTTGTGG + Intergenic
1087256673 11:95963819-95963841 TAGTCTCTTGCTTTTCTTTGCGG + Intergenic
1087856671 11:103100277-103100299 CAGTATCCTTCTATTCTTTCTGG - Intergenic
1089650462 11:119909519-119909541 GAGTTTCCTTCTTTTTCTTGGGG - Intergenic
1090696969 11:129255513-129255535 GTGTATCATGTTTTTCTTTATGG - Intronic
1091511538 12:1132007-1132029 GTGTGTCCTGCTGGTCTTTGAGG + Intronic
1095391009 12:41706619-41706641 GAGTTTCATTCTTTTCTTTTAGG - Intergenic
1096524343 12:52201640-52201662 GATTATCCTGATTGTCTGTGTGG + Intergenic
1098485806 12:71020351-71020373 TCGTATCCTACTTTTCTTTTTGG + Intergenic
1100180095 12:92075932-92075954 GTGTCTACTGCTTTTCTCTGGGG + Intronic
1100276691 12:93077880-93077902 AAGGATCCTGATTTTCTTTCGGG + Intergenic
1100939748 12:99713125-99713147 GATTATCCTGCATATATTTGTGG - Intronic
1103287697 12:119816465-119816487 GAGTTTCTTGCTCATCTTTGTGG - Intronic
1105665944 13:22556541-22556563 TGTTATCCTGCTTTCCTTTGAGG - Intergenic
1106054834 13:26228504-26228526 AAGTATTCTGCTTTTCTTCTTGG + Intergenic
1106707699 13:32299551-32299573 GAGTATCCTACTTTTTTCTCAGG - Intergenic
1107274427 13:38661992-38662014 GATAATCCTGCTTTTCTTTAGGG - Intergenic
1108007161 13:45960783-45960805 GCGTTTACTGCTTTTCTTTGTGG - Intronic
1110577525 13:77076350-77076372 GAGAAAACTGCTTTTGTTTGGGG + Intronic
1110621607 13:77602194-77602216 GAGTGTTATGCTTTCCTTTGTGG + Intronic
1111900535 13:94194348-94194370 GAGTGTCCTGCATTTTTTTCTGG + Intronic
1111911472 13:94316874-94316896 GATTTTTCTGCTTTTCTTTCTGG + Intronic
1112052813 13:95660691-95660713 GATTATGCTGCTTTTCCTAGTGG - Intergenic
1112676205 13:101705118-101705140 TAGTATCCTGTCTTTCTTTCAGG + Intronic
1113146402 13:107212874-107212896 GAGTTGCCTGTTTTTCTTTAAGG + Intronic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1114570816 14:23666851-23666873 AAGTATCCAGTTTTTCTTTCTGG + Intergenic
1114640660 14:24217605-24217627 GAGTTTCCTGGATCTCTTTGGGG + Intronic
1114853592 14:26410961-26410983 GATTATCCAGTTTTTCTTTCTGG + Intergenic
1115341970 14:32302258-32302280 TAGAATCCTGTCTTTCTTTGGGG - Intergenic
1115596213 14:34912056-34912078 GAATATTCTGGTTTTGTTTGTGG + Intergenic
1117675262 14:58149406-58149428 GGGGACCATGCTTTTCTTTGTGG - Intronic
1121224457 14:92311101-92311123 GAGTATTCTGCTTTTTCTTTAGG + Intergenic
1121828793 14:97032652-97032674 GGGTATCCAGCTTCTTTTTGGGG + Intergenic
1121952921 14:98187644-98187666 GAGGATCCTGGATTTCTTGGTGG + Intergenic
1124179622 15:27460440-27460462 GAGTTTCCTGGTTCTCCTTGCGG - Intronic
1125068496 15:35522558-35522580 GAGGAGCCTGTTTTTCTTTCAGG - Intronic
1126708191 15:51427311-51427333 GAGGAACCTGTTTTTCTTTATGG - Intergenic
1127391104 15:58505831-58505853 GAGTATCCTGCTTTCATTAGGGG + Intronic
1128375031 15:67067916-67067938 GAGTATGCTACTTCTCTTTCTGG + Intronic
1128710296 15:69866674-69866696 GAGAATCCTGGTTTTCTTTCAGG + Intergenic
1132323053 15:100941563-100941585 GAGTTTCGTGCTTCTCTTTATGG + Intronic
1133485844 16:6217633-6217655 GAGTAACCTGCTTGTCTCTTGGG + Intronic
1133601934 16:7348256-7348278 ATGTATCCTGGATTTCTTTGTGG + Intronic
1134902514 16:17951374-17951396 AAGCATCCTGTTTGTCTTTGTGG - Intergenic
1135514310 16:23116904-23116926 GAATAACATGCTTTTCTCTGTGG - Intronic
1136041687 16:27584384-27584406 CAGTATCCTGATTTTCCTTTTGG - Intronic
1138924743 16:61576979-61577001 GAGTGTGCTGGTCTTCTTTGTGG + Intergenic
1140274319 16:73495257-73495279 GAGCATCTTCCTTTTCTTTAGGG - Intergenic
1140692839 16:77500878-77500900 GAATTTCCTGTTTTTCTTTGTGG - Intergenic
1140746093 16:77981777-77981799 AAGTTTCCTGGTTTTATTTGTGG + Intergenic
1141044987 16:80707970-80707992 TAGCATCCTGCCTTTCTTTCTGG - Intronic
1141871469 16:86789379-86789401 GATTATCCTGCTGTGCTCTGCGG + Intergenic
1143837635 17:9704638-9704660 GAGCATCCTGGTTTTGTTTTGGG + Intronic
1144208673 17:12996793-12996815 GTCTCTCCTGCTTTGCTTTGAGG + Intronic
1144232290 17:13220085-13220107 GATTATCTTGTTTTTTTTTGTGG + Intergenic
1144793047 17:17872434-17872456 AAGTATCCTTTTTTTCTTTTAGG - Intronic
1145097069 17:20039373-20039395 GATTTGCCTGCTTTTCTTTCAGG + Intronic
1145147857 17:20495691-20495713 GAGGGTCCTGCTTTTCTTCTAGG - Intergenic
1146430067 17:32784801-32784823 CAGTATCTTCCTTTTCTGTGGGG - Intronic
1147119062 17:38324827-38324849 GAGTAACCTACTCTCCTTTGGGG - Intergenic
1147199122 17:38787919-38787941 GAGCATCCTACTAATCTTTGGGG + Intronic
1151884122 17:76913428-76913450 GAGGATGCTGCTCTTCTCTGAGG + Intronic
1153862211 18:9223972-9223994 TATTATCTTGCTTTTCTCTGTGG - Intronic
1155241940 18:23872249-23872271 GAATATCCTGGATTTCTTAGAGG + Intronic
1157715761 18:49885873-49885895 GTGTATCCTACTTTTCTCTATGG - Intronic
1157905654 18:51567585-51567607 AAGGATCCTGCTTTTCTTTTTGG - Intergenic
1159080805 18:63733479-63733501 CACTATTCTGTTTTTCTTTGTGG - Intergenic
1159347228 18:67221820-67221842 GTGTCTCGTGTTTTTCTTTGGGG - Intergenic
1159487798 18:69087741-69087763 AAATATCATGCTTTTCTTTATGG - Intergenic
1165555723 19:36630195-36630217 CATTATCCTGCCTTTCTTTTGGG - Intergenic
1168059310 19:53882449-53882471 CAGGATCCTGCCTTTCTTGGGGG - Exonic
1168161405 19:54512804-54512826 GACTGTCCTGCTTTTCACTGTGG - Intergenic
929543401 2:42840056-42840078 CACTTTCTTGCTTTTCTTTGTGG - Intergenic
932512752 2:72311571-72311593 GATTATCCTGATTATCTTGGTGG - Intronic
934893878 2:98095097-98095119 GGGTATTCTGGCTTTCTTTGTGG + Intronic
935107776 2:100061771-100061793 GAGAATTTTGTTTTTCTTTGAGG + Intronic
937649244 2:124301578-124301600 GTGTGTCCTGCTTTCTTTTGTGG - Intronic
939446972 2:142322499-142322521 GTGTCTCCTCCTTTTCTTTAGGG + Intergenic
939626114 2:144479665-144479687 GTGTATGCTACTTTTTTTTGGGG + Intronic
940715902 2:157223415-157223437 GAGTTTCCTGCTTTTCTTCCTGG + Intergenic
945976166 2:216272656-216272678 GCTTATCCTGCTTATCTTTTGGG + Intronic
946804601 2:223459131-223459153 GCATATCCTTCTTGTCTTTGTGG - Intergenic
1169826476 20:9774036-9774058 CCATATCCTGCTTTGCTTTGTGG - Intronic
1169863197 20:10173038-10173060 CACTAACCTGCTTTGCTTTGGGG - Intergenic
1171310815 20:24143361-24143383 GTTAATCCTGCTTTGCTTTGGGG + Intergenic
1173401085 20:42726518-42726540 CAGAATCCTGGTTTTGTTTGTGG - Intronic
1175051527 20:56159944-56159966 GAGTACCCTGATTTCCTTTGCGG + Intergenic
1176086829 20:63299432-63299454 TGGTATCCTGTGTTTCTTTGTGG + Intronic
1176342032 21:5708018-5708040 GAGTCTCCTGCTTACATTTGTGG - Intergenic
1176474286 21:7140170-7140192 GAGTCTCCTGCTTACATTTGTGG - Intergenic
1176502795 21:7616438-7616460 GAGTCTCCTGCTTACATTTGTGG + Intergenic
1176536353 21:8106087-8106109 GAGTCTCCTGCTTACATTTGTGG - Intergenic
1178144645 21:29724868-29724890 GAGTTTCTTCCTTTTCTTGGAGG + Intronic
1178362232 21:31958222-31958244 GAAACTCCTGCTTTTCTCTGTGG + Intronic
1184003200 22:41690157-41690179 CAGTATCCTGATTTCCTGTGGGG - Intronic
1184213640 22:43051950-43051972 GACGATCCTGCTTGTCTCTGTGG - Intronic
950069790 3:10142722-10142744 AAGGATGCAGCTTTTCTTTGAGG - Intronic
950501824 3:13369132-13369154 GAGTGTAGTGCTTTTCATTGTGG + Intronic
950906040 3:16539100-16539122 CAGCATCCTGGCTTTCTTTGAGG - Intergenic
951643227 3:24859272-24859294 GAGGGTTTTGCTTTTCTTTGAGG + Intergenic
952244247 3:31568185-31568207 GAGTCTCATTCTTTTCTTTATGG + Intronic
952858411 3:37792398-37792420 GAGTAGCCTGCTTTAGATTGGGG + Intronic
952897578 3:38088274-38088296 GGGTAATCTGCTTTTCTTTAAGG + Exonic
953486649 3:43304702-43304724 GAGTATTCTGCTTGCATTTGTGG + Intronic
953884205 3:46706378-46706400 GGGTTTCCTGCTTTTAATTGAGG - Intronic
954331406 3:49892527-49892549 GCTTCTGCTGCTTTTCTTTGAGG - Intronic
954407035 3:50350925-50350947 GAGTATCCCGCTTTCTTTGGAGG + Exonic
954913000 3:54123792-54123814 GAGTATCCTGCTTTTCTTTGTGG - Intronic
958562175 3:95760191-95760213 CTGCAGCCTGCTTTTCTTTGTGG + Intergenic
960792192 3:121445229-121445251 GAGTCCCAGGCTTTTCTTTGTGG + Intronic
963467147 3:145697832-145697854 GAGTATTCTGCTTTCTTTTTTGG - Intergenic
966234336 3:177684035-177684057 GAGTCTCCTGCTGTTCTTATGGG + Intergenic
967697636 3:192551746-192551768 GAGTATTTTTTTTTTCTTTGAGG - Intronic
972009632 4:34160471-34160493 TAGTACTCTGTTTTTCTTTGTGG - Intergenic
972135668 4:35890231-35890253 CAATAGCCTACTTTTCTTTGGGG + Intergenic
977630094 4:99232997-99233019 GAGTATTCTGCTTCTCTGTTAGG + Intergenic
978085820 4:104652182-104652204 GTGTTTTCTGCTTTTCTTTAAGG - Intergenic
978252922 4:106654931-106654953 AATTCTCCTGCTTTTCTTAGTGG + Intergenic
978615563 4:110591568-110591590 GAGGATCCTGCTTTTCATATTGG - Intergenic
978675458 4:111309468-111309490 TAGTATCCTGCTTTTCCCTGGGG - Intergenic
981037126 4:140183575-140183597 TTATATCCTGCTTTTATTTGTGG - Intergenic
981870683 4:149481908-149481930 GAGTATCTTTCCTTTTTTTGGGG + Intergenic
981910213 4:149970828-149970850 AATTATCCTGCTTATTTTTGTGG - Intergenic
981935429 4:150234596-150234618 GAGTACCCGTCTTTTCTTTTTGG + Intronic
982160105 4:152560328-152560350 GAGTATCTTGCCTATCTTGGGGG + Intergenic
985282383 4:188300261-188300283 GGGAATCCTGCTATCCTTTGTGG - Intergenic
987328709 5:16835766-16835788 TAGTAACCTACTTTTTTTTGGGG - Intronic
988366516 5:30307545-30307567 AAGTATCCTTCTTTTCTTCATGG - Intergenic
989627560 5:43445083-43445105 AAGGTACCTGCTTTTCTTTGTGG - Exonic
990994788 5:61721094-61721116 GAGTACCCAGCTCTTCTTTTAGG + Intronic
991118381 5:62981259-62981281 GAGTATCTTCATTTGCTTTGAGG + Intergenic
991587145 5:68213186-68213208 GAGTATCCTACCATACTTTGGGG + Intergenic
992189930 5:74281730-74281752 ATGTATCGTGCTTTTGTTTGGGG - Intergenic
992364295 5:76076196-76076218 GAGAATCCTGATTTTATTTAGGG - Intergenic
993292698 5:86095728-86095750 GCGTATCCTTCTTTTACTTGAGG - Intergenic
993534346 5:89063377-89063399 GAGTAGCTTGGTTTTCTTTAAGG - Intergenic
993850823 5:93006388-93006410 TAGAATCCTCCTTTTCTTGGAGG + Intergenic
994341352 5:98632385-98632407 GATTTTGCTGTTTTTCTTTGCGG - Intergenic
995514439 5:112939996-112940018 GAGAATACTGATTTTTTTTGCGG + Intergenic
995842708 5:116458987-116459009 TAGTCTCCGTCTTTTCTTTGAGG - Intronic
998081542 5:139279223-139279245 GAGTATCAGACTTTTTTTTGGGG + Intronic
998821632 5:146062770-146062792 GGGCATCCTGCCATTCTTTGGGG + Intronic
999041026 5:148412736-148412758 TGGTATCCTGCTTTTCTCTTGGG + Intronic
999135809 5:149317993-149318015 GAGTGTCATGTTTTTGTTTGGGG + Intronic
1000403378 5:160857966-160857988 GAATATTCTACTTTTCTTGGGGG + Intergenic
1000420133 5:161029237-161029259 GCGTCTCCTGTTTTTCCTTGAGG + Intergenic
1000761386 5:165229504-165229526 GAGTACCCTGCTTTGGTTTATGG + Intergenic
1000871404 5:166581671-166581693 TAGTATCCTTTTTATCTTTGGGG - Intergenic
1001717278 5:173826530-173826552 GGGTAACCAGCTTCTCTTTGGGG - Intergenic
1003796950 6:9615355-9615377 GAGTATACACCTTTTTTTTGGGG + Intronic
1004161820 6:13221095-13221117 GAGCATCCTGCCTATCTTTCAGG - Intronic
1005139522 6:22612029-22612051 TTGTAACCTGCTTGTCTTTGAGG - Intergenic
1005530510 6:26700444-26700466 ATGTATCCTGCTTTTTCTTGAGG + Intergenic
1005540286 6:26801202-26801224 ATGTATCCTGCTTTTTCTTGAGG - Intergenic
1007309980 6:40937717-40937739 GAATTTCCTGCTGTTCTTTCAGG + Intergenic
1007983281 6:46180819-46180841 AAGTAACCTGCTTTTCTTGAGGG + Intergenic
1008869268 6:56252766-56252788 CAGCATCCTGATTTTCTTTGAGG - Intronic
1009011103 6:57843302-57843324 ATGTATCCTGCTTTTTCTTGAGG - Intergenic
1011370229 6:86629348-86629370 CAGCATCCTGCTTTCGTTTGTGG + Intergenic
1011447705 6:87460264-87460286 GAATATACTGATTTTCTTTTGGG - Intronic
1011739062 6:90341355-90341377 GAGTTACCTGTATTTCTTTGTGG - Intergenic
1012786129 6:103628866-103628888 GACTCTCCTGCTTTTCTCTCTGG - Intergenic
1020606777 7:10347937-10347959 TAGTATGCTGCTTTATTTTGGGG + Intergenic
1021301188 7:18975012-18975034 GATTCTCCTGCTTTGATTTGGGG + Intronic
1022269396 7:28791461-28791483 GAACCTCCTGCTTTTCTTTGTGG - Intronic
1026824054 7:73570387-73570409 GAGTCTCCTGGTTTTCTTACTGG - Exonic
1028296741 7:89142213-89142235 GAGAATCCTTCTTTTTTTTTAGG - Intronic
1028384035 7:90233517-90233539 GATTATACTGATGTTCTTTGAGG + Exonic
1028661741 7:93285065-93285087 GAGAATCCTGCTTATCTGAGTGG - Intronic
1030289730 7:107859944-107859966 GAGCACCCTGGTTTTCTCTGGGG - Intergenic
1030679929 7:112424054-112424076 AAGGATAATGCTTTTCTTTGGGG + Intronic
1033726602 7:144124918-144124940 GTTTATCTTGCTTTTCTTTTTGG - Intergenic
1035970979 8:4248699-4248721 TTGTATCCTGCTCTTCTTTTTGG + Intronic
1036950145 8:13132791-13132813 GAGTCTCCGGATTTTCTTGGAGG - Intronic
1037497446 8:19453571-19453593 CAGTTTCCTGTTTTGCTTTGTGG - Intronic
1037821434 8:22137080-22137102 GATTATCCAGGTTTTATTTGGGG - Intergenic
1041246406 8:55892542-55892564 AAGTATCTTTCTTTTTTTTGAGG + Intronic
1043554840 8:81419573-81419595 GAGTTTGGTGCTGTTCTTTGAGG - Intergenic
1043689894 8:83137751-83137773 GAAAATCCTGTTTTTTTTTGTGG + Intergenic
1045163040 8:99570773-99570795 GAGTATCCTTTTTGTCATTGAGG + Intronic
1046171415 8:110512432-110512454 GAGTATCCTCCATATCTTTATGG + Intergenic
1046330756 8:112712200-112712222 GAGGATCCTGCTCTTCATAGTGG - Intronic
1046780204 8:118206551-118206573 AAGTATCCTGCATTGCCTTGGGG + Intronic
1050236463 9:3586272-3586294 GACTAACCTCATTTTCTTTGGGG + Intergenic
1051229246 9:14937177-14937199 GTGCAGCATGCTTTTCTTTGTGG + Intergenic
1052510319 9:29409775-29409797 GAGTATCATGCATTTATTTATGG + Intergenic
1053293965 9:36900100-36900122 GAACATCCTTCTTTTGTTTGGGG + Intronic
1053480584 9:38413748-38413770 GTGTATCCTGCTTCACTTCGGGG - Intronic
1053612937 9:39733537-39733559 GATTTTCTTGCTTTTCTTTCAGG + Intergenic
1054240577 9:62608865-62608887 GATTTTCTTGCTTTTCTTTCAGG - Intergenic
1054554713 9:66643387-66643409 GATTTTCTTGCTTTTCTTTCAGG - Intergenic
1056134121 9:83614546-83614568 GTGTATCCATCTTTTCTTTATGG + Intergenic
1061698588 9:132397320-132397342 TACTAGCCTGCTTTTCTTCGTGG + Intronic
1061733758 9:132637853-132637875 GACTTTCGTGCTTTTCTCTGGGG - Intronic
1062232653 9:135490744-135490766 CAGGAACCTGCATTTCTTTGTGG + Intergenic
1062341104 9:136094419-136094441 GAGTTTCCTGCTTCTCTTGCTGG - Intronic
1203457621 Un_GL000220v1:5572-5594 GAGTCTCCTGCTTACATTTGTGG - Intergenic
1187887538 X:23903577-23903599 GAGTATACTGATTTACTTTTTGG - Intronic
1190764952 X:53468363-53468385 GAGTATAGGGCTTTTCTTTGGGG - Intergenic
1192281594 X:69693100-69693122 GATTGTTCTTCTTTTCTTTGGGG + Intronic
1194426627 X:93746901-93746923 CAGTATCCTGATTGTTTTTGAGG - Intergenic
1195106449 X:101606847-101606869 CAGTATACTGCTGTTCCTTGGGG + Intergenic
1195536774 X:106016668-106016690 GTGTATTCTGCTGTTTTTTGTGG + Intergenic
1196070297 X:111513394-111513416 TAGTATCCTGCAGTTCTTTCTGG - Intergenic
1196798839 X:119524076-119524098 GAATATCCTGCTTTTTTTCCAGG - Intergenic
1197080032 X:122401231-122401253 GATTGTCCTCCTTTTCTTTTTGG + Intergenic
1197333502 X:125182300-125182322 GATTATCCTGGTTATCTCTGTGG - Intergenic
1200168045 X:154050807-154050829 GTGGCTCCTGCTTCTCTTTGTGG - Intronic
1200844878 Y:7821745-7821767 GACTATCCTGCTTTTACTTCAGG + Intergenic
1201456235 Y:14170024-14170046 GATTATTCTACTTTTCTTTTGGG - Intergenic
1201494176 Y:14575674-14575696 GAGTTTCCTGTTTTTCTGTTCGG + Intronic
1201923855 Y:19263580-19263602 GAATACCATGCTTTTCTTTAAGG - Intergenic
1202271000 Y:23073851-23073873 CAGCATCCTGGCTTTCTTTGAGG - Intergenic
1202295026 Y:23346831-23346853 CAGCATCCTGGCTTTCTTTGAGG + Intergenic
1202423995 Y:24707595-24707617 CAGCATCCTGGCTTTCTTTGAGG - Intergenic
1202446794 Y:24962490-24962512 CAGCATCCTGGCTTTCTTTGAGG + Intergenic