ID: 954913775

View in Genome Browser
Species Human (GRCh38)
Location 3:54131604-54131626
Sequence TTGTTCATGAATAATGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 292}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954913775 Original CRISPR TTGTTCATGAATAATGAAGT GGG (reversed) Intronic
901419567 1:9141696-9141718 TTATTCATGAATAAAGAAAATGG - Intergenic
904152703 1:28455497-28455519 TTGTTGAAGAAAAATGAATTAGG - Intronic
904629716 1:31831688-31831710 TTGTTCATATACACTGAAGTTGG - Intergenic
907425963 1:54379557-54379579 TTGTTCATGTAAAATGTGGTGGG - Intronic
907948588 1:59158416-59158438 TTTCTAATGAATAATGATGTTGG - Intergenic
908808105 1:67951530-67951552 TTTTTCAGCAACAATGAAGTGGG - Intergenic
909874150 1:80781091-80781113 TTATTTATGAATACTGAAATAGG - Intergenic
910321939 1:85955677-85955699 TCTTTCATTAATAATGAAATGGG - Intronic
912313790 1:108648312-108648334 TTTCTCAAGAATAAAGAAGTTGG - Exonic
912414084 1:109496403-109496425 TTGTTGAGGAATAATTCAGTGGG + Exonic
913031152 1:114904030-114904052 TTGAAAATGAATAATAAAGTTGG - Intronic
916970942 1:170015105-170015127 TTGTTAACAAATTATGAAGTGGG + Intronic
917934823 1:179855771-179855793 ATGTTCATTAATAAGAAAGTGGG + Intronic
920551240 1:206863066-206863088 TTGTTCAGGAATAAAGGATTTGG + Intergenic
920948485 1:210551544-210551566 TTTATCTTGAATAATGAAGGGGG - Intronic
921321385 1:213943158-213943180 GTTGTCATGAATAATGTAGTAGG + Intergenic
922660662 1:227427704-227427726 TGTTTCTTCAATAATGAAGTAGG - Intergenic
924148847 1:241107027-241107049 TTGTTCATGACAATTGAATTTGG - Intronic
924446794 1:244140341-244140363 TTGTTTACAAATAATGAAGAAGG - Intergenic
924833647 1:247626753-247626775 TTGTACTTGAATAATGATATAGG + Intergenic
1063819868 10:9821347-9821369 TTGTTTAGGTATAATGAGGTAGG + Intergenic
1065484631 10:26225953-26225975 TTGTTCATGAGGAATGAGGTGGG + Intronic
1066613094 10:37270156-37270178 GTTTTCTTGAATATTGAAGTTGG + Intronic
1067710963 10:48650947-48650969 GTGTTCATGAAGAACGGAGTGGG - Intronic
1070405988 10:76095757-76095779 TTCTTAATGACTAATGATGTTGG + Intronic
1071212871 10:83364753-83364775 TTGTTCATGCTTATTGAAATAGG - Intergenic
1072281532 10:93870195-93870217 TTTTTGATGAATTATGAAGCTGG - Intergenic
1073364950 10:102931918-102931940 TCCTTAATGACTAATGAAGTTGG + Intronic
1074033430 10:109712618-109712640 TTTCACATGAATAATGATGTTGG + Intergenic
1074996533 10:118761840-118761862 TTGTGAATGCATAATGCAGTTGG + Intergenic
1076151477 10:128165529-128165551 TAGTTGCTGAATATTGAAGTGGG + Intergenic
1076934684 10:133559567-133559589 GTGTTCAAGAGAAATGAAGTAGG + Intronic
1077819140 11:5718720-5718742 ATGATGATGAAGAATGAAGTGGG - Intronic
1078151490 11:8763141-8763163 TTGTTGATGACTAATAAAGTTGG - Intronic
1079900370 11:26175558-26175580 ATGTTTATGAGTAAAGAAGTAGG + Intergenic
1081069088 11:38587225-38587247 TTGTTCATAAATTTTTAAGTAGG + Intergenic
1082639629 11:55642139-55642161 TTTTTCAAGAAAAGTGAAGTGGG + Intergenic
1083194388 11:61075340-61075362 TTGTTGATGAATGATAAAGAAGG + Intergenic
1085551502 11:77377613-77377635 TTGTTCATGAATACTTAAGTAGG + Intronic
1086233617 11:84599567-84599589 TAGTTCATGAAGAAGGAAATAGG + Intronic
1086723516 11:90150893-90150915 TTATATCTGAATAATGAAGTGGG - Intronic
1088146463 11:106686319-106686341 ACTTTCATGAATACTGAAGTAGG - Intronic
1088468590 11:110169468-110169490 TTTATCTTGAATAAGGAAGTTGG - Exonic
1088655284 11:111993300-111993322 TTCTTCAAGAGTAATGAAGAAGG - Intronic
1089581410 11:119483868-119483890 TTGTCCATGAATAAAAAAGCGGG - Intergenic
1089883664 11:121798724-121798746 TTATTTCTGACTAATGAAGTGGG + Intergenic
1090138207 11:124222854-124222876 TTCCTGATGAATAATGAATTTGG + Intergenic
1090681570 11:129064812-129064834 TTTTTCATGAAAAGTGAATTAGG + Intronic
1090869676 11:130732432-130732454 TTGGTCAAGTATAATGAAGGAGG - Intergenic
1090969391 11:131627191-131627213 TTGTGCATGAATAAAGCAGGCGG + Intronic
1091517818 12:1202701-1202723 TGATTCATGAATAATAAAGTAGG + Intronic
1092399004 12:8156206-8156228 TTGATCTTGAAAAATGAAATTGG - Intronic
1093521552 12:20057163-20057185 TTTTTGATGAGTAATAAAGTTGG + Intergenic
1093737153 12:22634145-22634167 TTCATCATGAATGATGAATTTGG + Intronic
1096328243 12:50685207-50685229 TTGTTCTTAAATTATTAAGTTGG + Intronic
1098566358 12:71941680-71941702 TTCTCCTTGAAGAATGAAGTTGG + Exonic
1099742462 12:86657968-86657990 TTCTTCATGATTATTAAAGTAGG - Intronic
1100104990 12:91159215-91159237 ATGTTCATGATCAATGAAGATGG - Intronic
1100232830 12:92626802-92626824 CTGTTTATGAATCATGAAATGGG + Intergenic
1100977899 12:100141937-100141959 ATGTTCAGTAATAATGATGTGGG + Intronic
1103470031 12:121173013-121173035 TTTTTCAAGAATAATTAAGGAGG - Intronic
1104611946 12:130236066-130236088 TGTTTAATGAATAATAAAGTCGG - Intergenic
1106434729 13:29713296-29713318 TTGATCATGAATAAAGCAGAGGG - Intergenic
1106657869 13:31766653-31766675 TTGTTCATGAAAATTGTGGTGGG - Intronic
1107130757 13:36892221-36892243 TATCCCATGAATAATGAAGTTGG + Intronic
1107822481 13:44298517-44298539 TTCTTGATGACTAATGATGTTGG + Intergenic
1108452846 13:50584867-50584889 TTGTTCATGGATAAGTAAATTGG - Intronic
1109529047 13:63616326-63616348 TTGTTCATGAATTTTGAACATGG + Intergenic
1109704178 13:66067743-66067765 TTGTTGATGAATAATGAGAGAGG + Intergenic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1109989560 13:70036669-70036691 TTGTTCATTTTCAATGAAGTAGG + Intronic
1110077843 13:71271866-71271888 TTGTTTTTGAGTAATGAATTTGG + Intergenic
1110465434 13:75795016-75795038 GTGTTCATGAAAAAAGAACTGGG - Intronic
1110488792 13:76078309-76078331 TTGTTCATTCAGAATGATGTCGG + Intergenic
1110807648 13:79775874-79775896 TTCCTCATTAAAAATGAAGTTGG - Intergenic
1111882520 13:93975433-93975455 TTATTCATGAATGATGAGCTGGG + Intronic
1112626018 13:101104861-101104883 ATGTGCATGGAAAATGAAGTTGG + Intronic
1114838710 14:26235851-26235873 TTGATCATGAATGATGAGTTTGG + Intergenic
1115089322 14:29554976-29554998 TTGTTCAAGGATAATGATATGGG - Intergenic
1115099573 14:29682561-29682583 TTTTGAATGAATAATGCAGTGGG - Intronic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1116744629 14:48801330-48801352 ATGTTCGTGAATAATGACATTGG + Intergenic
1117520705 14:56548771-56548793 TGGTTCATGAAAGATGAATTGGG + Intronic
1117620633 14:57582634-57582656 ATGTTCATGAACAATCGAGTGGG - Intronic
1117863414 14:60118154-60118176 TTGTTTATTAATTATGAGGTTGG + Intronic
1117885989 14:60363686-60363708 TTGTTCATGAATCTGCAAGTTGG - Intergenic
1118111032 14:62720104-62720126 ATATTCATGAATGAAGAAGTGGG + Intronic
1120403473 14:84063674-84063696 TTTTTCATGAATAATGGGGCTGG - Intergenic
1120508481 14:85382768-85382790 TGGTTCATGAAAAATCAAGGAGG - Intergenic
1120548131 14:85835114-85835136 TGGTTCATGTAAAATGAAGGGGG + Intergenic
1121513476 14:94532795-94532817 TGGTTTATGAATAATTAAGGAGG + Intergenic
1121861114 14:97319567-97319589 TTACTTATGAATAAAGAAGTAGG - Intergenic
1202915095 14_GL000194v1_random:162353-162375 TGGTTCATGAAAAATGACTTTGG + Intergenic
1202877585 14_KI270722v1_random:20365-20387 TGGTTCATGAAAAATGACTTTGG - Intergenic
1123697291 15:22888171-22888193 TTTTTTATGAATAGTGAACTAGG - Intronic
1124357750 15:29009300-29009322 TTGTTCATGGAGACTAAAGTGGG + Intronic
1125239966 15:37563041-37563063 TTTTTCATTAATATTGATGTAGG + Intergenic
1127484857 15:59409417-59409439 ATGGTCATGAAGCATGAAGTAGG - Intronic
1127567361 15:60204809-60204831 TTTTTCATTAATAATGCAGGGGG + Intergenic
1127753954 15:62072115-62072137 TTTTCCTTTAATAATGAAGTTGG + Intergenic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1131644087 15:94323345-94323367 TGGGTAATGAAAAATGAAGTTGG + Intronic
1133853521 16:9527959-9527981 TTCTTCATGCATAATAAAATAGG + Intergenic
1135383536 16:22014306-22014328 TTGCTCATGGATAATAAAATCGG + Intronic
1135859984 16:26047417-26047439 ATGTTCATGAATATTCCAGTGGG + Intronic
1138080066 16:54082100-54082122 ATCTTCATGAATATTTAAGTAGG - Intronic
1138518407 16:57553621-57553643 TTGATAAAGAAGAATGAAGTTGG - Intronic
1138639842 16:58376301-58376323 TTCTTCATGACTAATGAAGTTGG + Intronic
1138640473 16:58382040-58382062 GTCTTCATGACTACTGAAGTGGG + Intronic
1139374072 16:66485909-66485931 TTGCTCATGAAGATTCAAGTTGG - Intronic
1141185901 16:81787032-81787054 TTGTTAATTAATAATGATGTTGG + Intronic
1142407651 16:89899907-89899929 ATGTTCATGGATAATGAAAGTGG + Intronic
1146413263 17:32607712-32607734 TTGTAAATGAAGAATAAAGTTGG + Intronic
1146455772 17:33008671-33008693 TTTTTCAAGAATAAAGCAGTGGG - Intergenic
1148673425 17:49430508-49430530 TTCTTGATGACTAATGATGTCGG - Intronic
1149195364 17:54113244-54113266 TTGTTCATCCATAAAGAACTAGG - Intergenic
1150518064 17:65835609-65835631 TTTTTGAAGAATAGTGAAGTTGG - Intronic
1150520407 17:65861648-65861670 TTTGTGATGACTAATGAAGTTGG - Intronic
1153817032 18:8799401-8799423 TTATTCAGGGAGAATGAAGTGGG - Intronic
1154044667 18:10893634-10893656 ATGAGCATGAATGATGAAGTAGG - Intronic
1154263202 18:12855929-12855951 TTTTTCATGTATTGTGAAGTTGG - Intronic
1154956403 18:21260895-21260917 TTTTTCATGAATACTAAAATCGG + Intronic
1155114837 18:22753925-22753947 TTGATCATTAATAAGGAGGTAGG - Intergenic
1155824401 18:30421063-30421085 TTTTTTATGACAAATGAAGTTGG + Intergenic
1156131000 18:33974412-33974434 GTGCTCATGAATAATGGAGGAGG + Intronic
1156874815 18:41996770-41996792 TTGATCATTAATAACAAAGTTGG - Intronic
1157311240 18:46555001-46555023 TTTTTAAAGAATAATGAAGGGGG + Intronic
1160099975 18:75911472-75911494 TTGTTAAGGAATAATTGAGTGGG - Intergenic
1160450447 18:78960426-78960448 TTGTTCAGGGATAATGCAGCTGG - Intergenic
1161754900 19:6125441-6125463 TTGTTAATGAATAAAGAAGTTGG - Intronic
1202673095 1_KI270710v1_random:12579-12601 TGGTTCATGAAAAATGACTTTGG + Intergenic
926335703 2:11861048-11861070 TTGTTAATGAATAAATAAATGGG + Intergenic
926521036 2:13913780-13913802 TTGTTTCTGAATAATGAAAATGG - Intergenic
929368756 2:41195161-41195183 TTGTTCCTGAAAAATAAAGAGGG - Intergenic
930100076 2:47596593-47596615 TTGATGATGAATAATGATTTTGG - Intergenic
930320682 2:49851165-49851187 TTCTTTAAGTATAATGAAGTAGG - Intergenic
930386705 2:50705627-50705649 TTTTTCTTGAATAATTCAGTGGG + Intronic
930854315 2:55996316-55996338 TTGATGATGAATAATGAATATGG + Intergenic
931083598 2:58803996-58804018 TGGGTCAAGCATAATGAAGTGGG + Intergenic
934127276 2:88908258-88908280 TTTTTCAAGAAAATTGAAGTTGG - Intergenic
937033041 2:118756798-118756820 TTGTTCTTGAAGAATGCAGGTGG - Intergenic
937621679 2:123995404-123995426 TTGTTCATGGTTAATGCAGCTGG + Intergenic
937767785 2:125681159-125681181 TTGTTAAGGAATAATGCAGCTGG + Intergenic
938178606 2:129159835-129159857 TTGATAAAGAAGAATGAAGTGGG + Intergenic
939359575 2:141151514-141151536 TTGTTCATAGATTATGAAGATGG + Intronic
939471543 2:142628239-142628261 TTGTTCATGCATATTTAAATAGG + Intergenic
939695133 2:145314119-145314141 TAGTTTTTGAACAATGAAGTTGG + Intergenic
939740959 2:145905167-145905189 TCCTTGATGAATAATGAAGTTGG + Intergenic
940448434 2:153807077-153807099 TTGGGCATGAATAATGATGATGG - Intergenic
940549536 2:155135658-155135680 TTGTTAAAGAATAATGATGAAGG + Intergenic
940636896 2:156308566-156308588 GTGTTAATGGAAAATGAAGTTGG - Intergenic
941341625 2:164312388-164312410 TTGTTCATTAATACGGAAGTGGG + Intergenic
941460615 2:165767030-165767052 TTATTTATGAATGATGAAGAAGG - Intronic
942580826 2:177414131-177414153 TTATTCATGATAAATGTAGTAGG + Intronic
942783441 2:179672716-179672738 TTTTTCATCTATGATGAAGTGGG + Intronic
943041012 2:182805091-182805113 TTTTTCATTAATAATGAAGGAGG - Intergenic
943601707 2:189929378-189929400 ATGTTTATGAAAAATGAAGGTGG - Intronic
944666560 2:201963923-201963945 TTGTTCAAGAAAAATGGATTTGG + Intergenic
945805540 2:214485600-214485622 TTCTTCCTGAAAAATGTAGTAGG + Intronic
1169833008 20:9845871-9845893 TTGTTCAAGAAGAATAAGGTGGG + Intergenic
1170541642 20:17394820-17394842 TAGTTTATGAATTATGAAGTTGG + Intronic
1171270474 20:23813095-23813117 TTATGCCTGAAAAATGAAGTGGG - Intergenic
1174749901 20:53101325-53101347 TTGGTCATTAATAATGAAAAAGG + Intronic
1176634448 21:9176999-9177021 TGGTTCATGAAAAATGACTTTGG + Intergenic
1176638871 21:9277794-9277816 TGGTTCATGAAAAATGACTTTGG - Intergenic
1178157278 21:29869444-29869466 TTGCTCTGGAATAATGAAATAGG + Intronic
1178398088 21:32260266-32260288 TCATTTAAGAATAATGAAGTGGG + Intergenic
1178593660 21:33933461-33933483 CTGTTCATCAGAAATGAAGTTGG + Intergenic
1179354950 21:40650609-40650631 GTCTTCATTAATAAAGAAGTGGG + Intronic
1180372175 22:12050638-12050660 TGGTTCATGAAAAATGACTTTGG - Intergenic
1180390302 22:12225006-12225028 TGGTTCATGAAAAATGACTTTGG + Intergenic
1180415633 22:12709463-12709485 TGGTTCATGAAAAATGACTTTGG - Intergenic
1180422914 22:12885300-12885322 TGGTTCATGAAAAATGACTTTGG - Intergenic
1182063209 22:27412624-27412646 TTGTTCAAGATTGATGAAGTTGG + Intergenic
1182303637 22:29353026-29353048 TTGTTCAGGAAAAATGTGGTGGG - Intronic
1184520251 22:44989482-44989504 TTGTTCATGAATGAGGAACGAGG + Intronic
949185567 3:1187703-1187725 TTGTTCATAAATCATTAAGTGGG + Intronic
949476261 3:4448781-4448803 ATGTTCATGAAAAATGGAGGTGG - Intronic
951760039 3:26137748-26137770 TTGTTTTTAAATTATGAAGTGGG - Intergenic
951924191 3:27888885-27888907 ATTTTCATAAATAATGAAGCAGG + Intergenic
952189945 3:31012222-31012244 TTTTTCATAAATAATGAGATGGG + Intergenic
953195019 3:40724121-40724143 TTGTTCACAAATAATAAAATAGG + Intergenic
954913775 3:54131604-54131626 TTGTTCATGAATAATGAAGTGGG - Intronic
955868405 3:63410538-63410560 TTGATCATGATTTATGGAGTAGG + Intronic
956325512 3:68048242-68048264 GGGTTCATGAATATTGAAGACGG + Intronic
956688191 3:71851918-71851940 TTGTTAATGGCTCATGAAGTTGG + Intergenic
957101988 3:75839280-75839302 TGGTTCATGAAAAATGACTTTGG + Intergenic
957208228 3:77226958-77226980 CTGTTAAAGAAAAATGAAGTTGG - Intronic
957581648 3:82080713-82080735 TTTTTCCTAAAAAATGAAGTTGG + Intergenic
957614664 3:82511097-82511119 TAGTTGCTGAAGAATGAAGTAGG + Intergenic
961159568 3:124711842-124711864 TTGTTCATGATTATTGAAGTTGG + Intronic
964506232 3:157403026-157403048 TTTTTGATAAATAATGAAGAAGG + Intronic
964955531 3:162351023-162351045 TTCTTAATGACTAATGAAGTGGG - Intergenic
966471959 3:180299834-180299856 TTGTTCCTTATTATTGAAGTAGG - Intergenic
968015900 3:195332529-195332551 TACTTAATGAAGAATGAAGTTGG - Intronic
1202748024 3_GL000221v1_random:127225-127247 TGGTTCATGAAAAATGACTTTGG + Intergenic
970188614 4:13488251-13488273 TTATTCATCAATAATGAAGGTGG + Intergenic
970942125 4:21646806-21646828 TTGTTCATGTTTAATGCAATGGG - Intronic
971923953 4:32981879-32981901 TAGTTCTTGAAAAATGACGTTGG + Intergenic
972310145 4:37873827-37873849 TTGTTGATGAATATTGAGGTTGG + Intergenic
972889624 4:43540682-43540704 TTGTTCAAGAATACTGCAATAGG + Intergenic
974278434 4:59758823-59758845 ATGTTCAGGAAGAATGAGGTAGG + Intergenic
974425688 4:61740485-61740507 TTATTAATGAATAATCAATTTGG - Intronic
974935602 4:68406286-68406308 ATGCACATGAAAAATGAAGTGGG + Intergenic
975222481 4:71829250-71829272 TTGTTCAAGACTACTGAAATAGG + Intergenic
976041735 4:80894119-80894141 TTTTTCATGATTAGTGAGGTTGG - Intronic
976805362 4:89040350-89040372 TTTTTCATTAATAATAAATTTGG + Intronic
976806027 4:89047906-89047928 TTCTTCATGAGTAATGATATTGG - Intronic
976912698 4:90326968-90326990 TTGCTTATGAAAAATGAAGATGG - Intronic
977025089 4:91808471-91808493 TTGTTCATTTAGAATGATGTTGG + Intergenic
977321262 4:95519440-95519462 TTGGTCATAAATAATGGTGTTGG - Intronic
978037710 4:104016422-104016444 TTACTCATAAATAATGAATTTGG - Intergenic
979215598 4:118160313-118160335 TTGTCCTTCAATAATGAAGGAGG + Intronic
980064070 4:128163842-128163864 TTGCTCAGTAATAATGGAGTTGG + Intronic
980508480 4:133755072-133755094 TTGTTCTTCAAAAATGAAATAGG - Intergenic
980543162 4:134221020-134221042 TATGTCATGAATAATAAAGTAGG - Intergenic
981892799 4:149758441-149758463 TTTTTCATGAATAATAACTTTGG - Intergenic
982560367 4:156922261-156922283 TTGTTCATGTGTACTGAATTGGG + Intronic
982795370 4:159637797-159637819 TTTTTCAAGACTATTGAAGTAGG + Intergenic
984111358 4:175619407-175619429 TTATTTATGTATAATGAAGTTGG + Intergenic
984641646 4:182172389-182172411 TATTTCATGAAAGATGAAGTTGG + Intronic
985034687 4:185826462-185826484 TTGTTTATGAATAATGCACAGGG - Intronic
985091432 4:186366476-186366498 TTATTCATGATTAATGAATCTGG + Intergenic
985363131 4:189196912-189196934 TTGCTCATGAACCATGATGTTGG + Intergenic
1202753759 4_GL000008v2_random:36206-36228 TGGTTCATGAAAAATGACTTTGG - Intergenic
986396583 5:7336505-7336527 TGTTGCATGAATAATGAAGTTGG + Intergenic
986817676 5:11430384-11430406 TAGTTCAAAAATAATGATGTAGG + Intronic
986990612 5:13548698-13548720 TTGGTTTTGAATATTGAAGTGGG - Intergenic
987626556 5:20408158-20408180 TTGTTCTTCAAAAATGAAGAGGG + Intronic
989547589 5:42692560-42692582 TGGTTCATGAAGAAAGAGGTTGG + Intronic
989996723 5:50842563-50842585 TTCTTCATAAAAAAAGAAGTAGG + Exonic
990970297 5:61498736-61498758 TTATTCAAGAATAATGTAGGTGG - Intronic
991253126 5:64585748-64585770 TTGTTTATGGATAATGTAATAGG - Intronic
991346020 5:65668984-65669006 TTGTTTATTAATAATGAAATTGG - Exonic
992118228 5:73563626-73563648 GTTTTCATGAAAAATAAAGTAGG + Intronic
992468175 5:77028138-77028160 CTGTTTATGAATAATCTAGTGGG + Intergenic
992938710 5:81739649-81739671 TTTTTAATGAATAACGGAGTGGG + Intronic
993135668 5:83958564-83958586 TTTTTCAGGAATAAAGAAGCTGG - Intronic
993705430 5:91164228-91164250 TTCTTTATCAATAATGAAGCTGG - Intergenic
993808651 5:92444887-92444909 TTTTTAATGAAAAATGAAGTTGG - Intergenic
994205140 5:97026569-97026591 TTCTTCATGAATAATAATTTTGG + Intronic
995797228 5:115954606-115954628 TTTTCCATGATTAATGAAGTGGG + Intergenic
996821779 5:127637485-127637507 CTATTCTTGAATATTGAAGTAGG + Intergenic
998097849 5:139407044-139407066 TTGTTCATGAATCTGGAATTTGG + Intergenic
998708088 5:144787953-144787975 GTGTTCATGAAGAAAGAAGATGG + Intergenic
998987359 5:147775329-147775351 TTGTTTATGATTAGTGAATTTGG + Intronic
1000502238 5:162066691-162066713 TTAATCATGAAAAATAAAGTGGG - Intergenic
1001368724 5:171173983-171174005 TAGTTCCTAAATAATGATGTGGG + Intronic
1002481159 5:179501884-179501906 TTGTGCATGAAGAATTGAGTAGG + Intergenic
1003580724 6:7338439-7338461 TTTCTCATGAAGAATGATGTTGG + Intronic
1003656108 6:8010246-8010268 CTCTTCTTGAATAATGAAGAAGG - Intronic
1004497540 6:16179107-16179129 TTGTTTTTTAATAATAAAGTTGG + Intergenic
1005527875 6:26669107-26669129 TGGTTCAGGAATAATGTAGCTGG - Intergenic
1005542921 6:26832561-26832583 TGGTTCAGGAATAATGTAGCTGG + Intergenic
1009013737 6:57874734-57874756 TGGTTCAGGAATAATGTAGCTGG + Intergenic
1009757649 6:67960121-67960143 GTGTTCATAAATATAGAAGTGGG + Intergenic
1010476164 6:76290660-76290682 ATGTTAAGGAATGATGAAGTTGG - Intergenic
1010534637 6:77011931-77011953 ATGTTCAGGAAGAATGAGGTAGG - Intergenic
1013764526 6:113559212-113559234 TTGGGCATGAAGAAGGAAGTGGG + Intergenic
1015012604 6:128369194-128369216 TTCTTCAGGAATATAGAAGTGGG - Intronic
1015236519 6:130977595-130977617 TTTTTCATGAGTACAGAAGTTGG - Intronic
1015356149 6:132279309-132279331 ATGGACATGAATAATGAATTTGG + Intergenic
1016516590 6:144899392-144899414 TTCTTGATGACTAATGATGTTGG + Intergenic
1017977612 6:159372017-159372039 TTGTTCATAAATCATGCATTGGG + Intergenic
1018496456 6:164351335-164351357 ATGTTCAAGAATAAGGAAGTAGG + Intergenic
1019838486 7:3414518-3414540 TTGATCACAAAAAATGAAGTTGG + Intronic
1020595295 7:10200214-10200236 TTGTGGAAGAATAATGAAGTGGG - Intergenic
1020849186 7:13328594-13328616 TTGTTCTTGAATAATAACTTAGG + Intergenic
1023016537 7:35973356-35973378 TTGTTCTTGTATATTAAAGTGGG + Intergenic
1025521203 7:61731962-61731984 TTGTTGTTGAATATTTAAGTTGG - Intergenic
1028699070 7:93755513-93755535 TCTTTGATGACTAATGAAGTTGG + Intronic
1029908112 7:104112892-104112914 TTCTTGATGAATAATAATGTTGG + Intergenic
1030046981 7:105506246-105506268 TATTTCATGAACAACGAAGTCGG + Exonic
1030210193 7:106988318-106988340 TTCTTCATTTATAATGAAATAGG - Intergenic
1032665588 7:134033087-134033109 TTGTTAATGGATAAAGTAGTTGG + Intronic
1033939002 7:146627740-146627762 TTGTACCTAAATAAGGAAGTTGG - Intronic
1037698263 8:21247201-21247223 CTGTTCATCAATAATGGGGTTGG - Intergenic
1039551549 8:38446708-38446730 TTTTTTATAAATAATGAAGAAGG - Intronic
1039666798 8:39542589-39542611 TTGTTCATTCATTATGATGTTGG + Intergenic
1040500535 8:48001124-48001146 TTGTCCTTGAATGATTAAGTTGG - Intergenic
1043002548 8:74777412-74777434 TTGTTCCTTAATAATGCACTTGG - Intronic
1043015254 8:74931821-74931843 TTTTTCATGAATCATGATTTTGG + Intergenic
1043178260 8:77049190-77049212 TTGTTCCTGAATTTTTAAGTTGG - Intergenic
1043793299 8:84501873-84501895 TTATTCATAAATAATAAATTGGG + Intronic
1044844665 8:96368786-96368808 TTGTAAAAGAATAATAAAGTGGG - Intergenic
1046421846 8:113995822-113995844 TCATTAGTGAATAATGAAGTAGG + Intergenic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1046473668 8:114712427-114712449 TTGATCACCAAGAATGAAGTGGG - Intergenic
1047749462 8:127869095-127869117 TTGTTAGTAAATCATGAAGTTGG + Intergenic
1048506661 8:135027765-135027787 CTGTACAAGAAGAATGAAGTGGG - Intergenic
1050686927 9:8181996-8182018 TTGTTGTTGAAGAAAGAAGTAGG - Intergenic
1050867237 9:10518249-10518271 TTCTTCATGATTTATGTAGTTGG - Intronic
1050932789 9:11350677-11350699 TTGTTCATAAATAGTGCAGATGG - Intergenic
1053169896 9:35871155-35871177 TTGTTCATGGATACTAGAGTAGG - Intergenic
1054713532 9:68535362-68535384 TTGTCCATGAAGCATGAATTTGG - Intergenic
1057367554 9:94437302-94437324 ATGCTGATGAATAATGAAATAGG - Intronic
1057655774 9:96950751-96950773 ATGCTGATGAATAATGAAATAGG + Intronic
1058483101 9:105416828-105416850 TTGTGCATGGATAGTCAAGTGGG - Intronic
1061273994 9:129558962-129558984 TGGTTAATGAATAATTAAGCTGG + Intergenic
1061432564 9:130540501-130540523 TTTTTCATGACAAATGAAGATGG - Intergenic
1061608688 9:131731329-131731351 TTGTTCATGAGTCATGGAATTGG - Intronic
1062397827 9:136359570-136359592 TTTTTCCTGAAAAATAAAGTCGG + Exonic
1203757285 Un_GL000218v1:144634-144656 TGGTTCATGAAAAATGACTTTGG + Intergenic
1203716663 Un_KI270742v1:157308-157330 TGGTTCATGAAAAATGACTTTGG + Intergenic
1203534548 Un_KI270743v1:20929-20951 TGGTTCATGAAAAATGACTTTGG - Intergenic
1203650895 Un_KI270751v1:120887-120909 TGGTTCATGAAAAATGACTTTGG + Intergenic
1187226473 X:17378318-17378340 TTGTACATGAATAATAAAGATGG + Intronic
1187523596 X:20034667-20034689 TTGTTCATGAATCAAGAAATGGG + Intronic
1187770798 X:22693352-22693374 TTGTTGATAAATATTGAAGCTGG - Intergenic
1188788569 X:34379928-34379950 CAGTTCAGGAATAATGAAGGTGG - Intergenic
1188993227 X:36850134-36850156 TTTTTCATGCATGAAGAAGTTGG - Intergenic
1189654608 X:43230320-43230342 TTGATAAAGAATAATAAAGTGGG + Intergenic
1189784138 X:44543937-44543959 TTGTTCATGACTACTGCAATAGG - Intergenic
1193815412 X:86099545-86099567 TTTTTCAAGAATAATGAATTTGG - Intergenic
1194695473 X:97044440-97044462 TTGTTAATGAATTATGAGGTAGG - Intronic
1195130684 X:101848065-101848087 AATTTCTTGAATAATGAAGTTGG - Intronic
1195287556 X:103399870-103399892 ATGTTCATGAATAATAAATATGG - Intergenic
1197383150 X:125770097-125770119 ATTTTCATTAATAATGAACTTGG + Intergenic
1199750536 X:150812893-150812915 TTTTTCATGTATAATTCAGTTGG - Intronic
1201170861 Y:11262254-11262276 TGGTTCATGAAAAATGATTTTGG + Intergenic
1202334731 Y:23795865-23795887 TTGATGATAAATTATGAAGTAGG - Intergenic
1202536036 Y:25874194-25874216 TTGATGATAAATTATGAAGTAGG + Intergenic