ID: 954914356

View in Genome Browser
Species Human (GRCh38)
Location 3:54136046-54136068
Sequence GATTTCCAGTGGAGATCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954914356_954914358 -6 Left 954914356 3:54136046-54136068 CCAGCTGATCTCCACTGGAAATC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 954914358 3:54136063-54136085 GAAATCTGTTCTAGTTTATGCGG 0: 1
1: 0
2: 0
3: 13
4: 169
954914356_954914359 -2 Left 954914356 3:54136046-54136068 CCAGCTGATCTCCACTGGAAATC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 954914359 3:54136067-54136089 TCTGTTCTAGTTTATGCGGAAGG 0: 1
1: 0
2: 1
3: 4
4: 73
954914356_954914360 -1 Left 954914356 3:54136046-54136068 CCAGCTGATCTCCACTGGAAATC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 954914360 3:54136068-54136090 CTGTTCTAGTTTATGCGGAAGGG 0: 1
1: 0
2: 0
3: 3
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954914356 Original CRISPR GATTTCCAGTGGAGATCAGC TGG (reversed) Intronic
902728106 1:18350712-18350734 AATTTCCAGGGGAGATGAGGTGG - Intronic
904118525 1:28179699-28179721 GATTACCAGCGGTAATCAGCAGG - Intronic
908006370 1:59733095-59733117 GAATTCCAGGGGAGCTCAGTAGG - Intronic
909091402 1:71230395-71230417 GATTTCCAGGGGAAAGAAGCTGG - Intergenic
911396272 1:97314762-97314784 GATTTCCTGTTGGGATTAGCCGG - Intronic
912617104 1:111113918-111113940 GATGTACAGTTGAGAGCAGCTGG + Intergenic
921660120 1:217791300-217791322 AATTTCCACTGGAAATTAGCTGG - Intronic
1062772231 10:111532-111554 GATTTCCAGTGGAGATTGAAAGG - Intergenic
1063364666 10:5482349-5482371 GATCTCGAGGGGAGATCAGCTGG - Intergenic
1063453699 10:6168553-6168575 GGTTTCCAGTGGCCACCAGCAGG - Intronic
1064477687 10:15708391-15708413 AATTTCCAGTGGAGACCAGGTGG + Intronic
1064565258 10:16633118-16633140 GATATCCAGTGGGTAACAGCCGG - Intronic
1064979300 10:21149858-21149880 GTTCTGCAGTGGACATCAGCTGG - Intronic
1076722888 10:132400448-132400470 GATCTCCAGGGGAGAGCAGGTGG - Intronic
1078677093 11:13431299-13431321 GTTTTCAAGTGGTGATCAGTTGG - Intronic
1079995114 11:27287470-27287492 CATTTCCAGTGTAAGTCAGCTGG - Intergenic
1080804857 11:35643325-35643347 AATTTCCTGTGTAGATCAGATGG + Intergenic
1082837403 11:57661425-57661447 GATCTGAAGTAGAGATCAGCAGG + Exonic
1083303843 11:61752839-61752861 CAGTTCCCGGGGAGATCAGCCGG - Intronic
1084071543 11:66739676-66739698 CTCTTCCAGTGGACATCAGCTGG + Intergenic
1084257164 11:67951057-67951079 GATTTCCATTTGAGCACAGCTGG - Intergenic
1084815611 11:71644211-71644233 GATTTCCATTTGAGCACAGCTGG + Intergenic
1085515097 11:77107090-77107112 GGTCTCCGGTGGAGAGCAGCAGG + Intronic
1086395723 11:86413191-86413213 GATGTCCAGAGCACATCAGCAGG - Intronic
1090325098 11:125879218-125879240 GCTCTGCAGTGGACATCAGCTGG + Intergenic
1091531230 12:1357865-1357887 GATCTCCAGCGCAGATCAGTGGG + Intronic
1092427398 12:8385843-8385865 GATTTCCATTTGAGCACAGCTGG - Intergenic
1092452687 12:8617677-8617699 GTTTTCCAGTGGACATCAACTGG + Intergenic
1097308862 12:58097117-58097139 GTTTTCCAGTGGACACCAGCTGG + Intergenic
1097541297 12:60946810-60946832 GTTCTCAAGTGGACATCAGCTGG - Intergenic
1098356525 12:69617571-69617593 GCGTTGCAGTGGAAATCAGCTGG - Intergenic
1099879479 12:88450376-88450398 TAGATCCAGTGGGGATCAGCTGG - Intergenic
1103094354 12:118120953-118120975 GAATTCCAGTTTAGACCAGCAGG - Intronic
1108825241 13:54405917-54405939 GATTTTCAGTGCAGAATAGCAGG + Intergenic
1109310692 13:60689279-60689301 GATTTCCAGTGAACATCTGTTGG + Intergenic
1113404529 13:110025933-110025955 GTTTTCCAGTGGAGGCCAGGTGG - Intergenic
1114375950 14:22147277-22147299 GCTTTCAAGTGGAGAGCAGCTGG - Intergenic
1118731628 14:68670871-68670893 CATTTCCAGCAGAGATGAGCAGG - Intronic
1120827034 14:88965541-88965563 GATTTCCAATTGAGATAAGCAGG + Intergenic
1122242356 14:100377254-100377276 TAGTTCCATTGGAGATGAGCTGG + Intronic
1124008459 15:25813486-25813508 GATTTCCAGTGAAAAAAAGCAGG + Intronic
1124256428 15:28146501-28146523 GATCTTCAGTGGGGATGAGCTGG - Intronic
1124375253 15:29125486-29125508 GGGCTCCAGTAGAGATCAGCTGG + Intronic
1126202779 15:46006560-46006582 GTTCTCCAGTGGACACCAGCTGG + Intergenic
1129778735 15:78254841-78254863 GTTCTGCAGTGGACATCAGCTGG - Intergenic
1131097683 15:89666525-89666547 GAGTTCCAGGGGACAGCAGCAGG - Intronic
1132166224 15:99594028-99594050 GTTCTCCAGTGGACACCAGCTGG + Intronic
1133370849 16:5244535-5244557 GATTTCCATTTGAGCACAGCTGG + Intergenic
1135039699 16:19108751-19108773 GATCTCCAGTTGAGATCAATGGG + Intergenic
1136081740 16:27856687-27856709 CATTTCCAGTGGTGATCTGAAGG + Intronic
1137604689 16:49779712-49779734 GATTTCCAGTGTCCACCAGCAGG + Intronic
1137863886 16:51873722-51873744 GATTGCTAGTGGACATTAGCTGG - Intergenic
1141707020 16:85671737-85671759 GATTTGCTGAGGAGAGCAGCAGG + Intronic
1148435651 17:47682427-47682449 GATTTCCAGTGGGGGTCCTCAGG - Exonic
1149310820 17:55391355-55391377 GATGTCAAGTGGGGTTCAGCTGG + Intergenic
1156259607 18:35432661-35432683 AATTGCCAGTGGAAATCTGCAGG - Intergenic
1156545468 18:37959902-37959924 AATCTTCTGTGGAGATCAGCTGG + Intergenic
1156606653 18:38674260-38674282 TTTTTCCAGTGGTGAACAGCAGG + Intergenic
1156989316 18:43388055-43388077 GTTCTCCAGTGGATACCAGCTGG - Intergenic
1160348136 18:78151678-78151700 GATTTCAAGTGGGGAACAGACGG + Intergenic
1167105728 19:47429142-47429164 GATTGTCAGGGGAGATCAACTGG + Exonic
1168590700 19:57632256-57632278 CACTACCAGTGGAGATCTGCTGG + Intronic
926380621 2:12284747-12284769 GGTTTCCAGGGTAGAACAGCAGG + Intergenic
928379232 2:30803449-30803471 GCTGACCAGTGGAGATCAGAGGG + Intronic
930686205 2:54311227-54311249 GATATACAATGGACATCAGCAGG - Intergenic
931975905 2:67644052-67644074 GATTTCCTGTAGTGATCAGAAGG + Intergenic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
935606458 2:104976277-104976299 AATTCTCAGTGGACATCAGCTGG + Intergenic
937045932 2:118851830-118851852 CATTTCGAGTGTAGATCAGATGG + Intergenic
940373345 2:152925827-152925849 CATGTCCAGTGCAGATCAGCCGG - Intergenic
941685584 2:168444976-168444998 CATGTCCAGTGTAGATCATCAGG - Intergenic
947363224 2:229367104-229367126 GACTTCCATTGGAGGTCTGCAGG + Exonic
947543972 2:230997754-230997776 GAATTCAAGTGGAGTTCAGGAGG + Intronic
1169007907 20:2224195-2224217 GTTTTCCAGTGGAGGGCAGGTGG + Intergenic
1169512843 20:6283888-6283910 GTTTTGCAGTGGACACCAGCTGG + Intergenic
1169937617 20:10901420-10901442 GGTTTCCAGTGGGGATAAGATGG + Intergenic
1170538469 20:17364892-17364914 GGTTGCCACTGGAGCTCAGCTGG + Intronic
1171043971 20:21793098-21793120 GGATTCCAGTGCAGATCAACTGG + Intergenic
1176177613 20:63736139-63736161 GTCATTCAGTGGAGATCAGCTGG + Exonic
1178110872 21:29369126-29369148 GATATTCAGTAGAGATCTGCGGG + Intronic
1178679970 21:34665805-34665827 GATTTCCAAAGAGGATCAGCTGG + Intergenic
1181009839 22:20033612-20033634 GGATTCCAGTAGAGACCAGCTGG + Intronic
1181192097 22:21149214-21149236 GATGTCCAGTGGTGACCAGGTGG + Intergenic
1183606066 22:38867241-38867263 GACATCCAGGGGAGGTCAGCGGG - Intronic
1183832908 22:40428321-40428343 GTTCTCCAGTGGACACCAGCTGG - Intronic
950750393 3:15123663-15123685 GATTTCCATTTGAGCACAGCTGG + Intergenic
952414451 3:33077725-33077747 GATATCAAGTGGAGATGAGATGG + Intronic
954914356 3:54136046-54136068 GATTTCCAGTGGAGATCAGCTGG - Intronic
955783790 3:62514574-62514596 CATTTCCAAAGTAGATCAGCTGG - Intronic
957072105 3:75575537-75575559 GATTTCCATTTGAGCACAGCTGG - Intergenic
961143394 3:124574414-124574436 GATTTACAGTGGGCACCAGCAGG - Intronic
961282036 3:125771548-125771570 GATTTCCATTTGAGCACAGCTGG + Intergenic
961496781 3:127298794-127298816 GCCTTACTGTGGAGATCAGCAGG - Intergenic
965357111 3:167689634-167689656 GATTTCCAGTATTTATCAGCAGG - Intronic
967776384 3:193390714-193390736 GTTCTCCAGTGGACACCAGCTGG + Intergenic
968535668 4:1126927-1126949 GATTTTTAGTTGAAATCAGCAGG - Intergenic
969015696 4:4102859-4102881 GATTTCCATTTGAGCACAGCTGG - Intergenic
969738268 4:9005503-9005525 GATTTCCATTTGAGCACAGCTGG + Intergenic
969797450 4:9537049-9537071 GATTTCCATTTGAGCACAGCTGG + Intergenic
969898558 4:10327491-10327513 GATTCTCAGGGGAGATCATCTGG + Intergenic
970135302 4:12915507-12915529 TATTCCCAGAGGAGATGAGCAGG + Intergenic
971967653 4:33581017-33581039 TATTTCCAGGGCAGATCACCAGG + Intergenic
974816209 4:67007052-67007074 GACTTCCGGTCCAGATCAGCTGG + Intergenic
975531898 4:75407975-75407997 CATATCCAGTGAAGGTCAGCTGG - Intergenic
978263720 4:106795685-106795707 GAGATCCAGTGGAGAGCAGCTGG + Intergenic
980805548 4:137808676-137808698 AATTTACAGTGGAGCTCAGTGGG + Intergenic
982147629 4:152414406-152414428 TATTTCCAGTTGAGATCTGCAGG - Intronic
982734790 4:158994676-158994698 GATGTGCAGTGCAGAACAGCTGG + Intronic
983519085 4:168688149-168688171 GAGTTACAGAGGAGATCAGCAGG - Intronic
986500712 5:8396176-8396198 GCTTTCCAGTGGAGGTCACGTGG - Intergenic
987382942 5:17302737-17302759 GATTCCCAGGGGAGAACAGGAGG - Intergenic
994736508 5:103562793-103562815 GACTTCCGGTGGAGATCCGGGGG + Exonic
995917246 5:117262687-117262709 GATTTCCAGCAGAGAGCAGCTGG - Intergenic
998037225 5:138927325-138927347 GAGTACAAGAGGAGATCAGCAGG - Intronic
998959571 5:147470393-147470415 GGTTTCCAGTGAAGATGACCAGG - Intronic
1000813573 5:165891832-165891854 GTTTTGCAGTGGACACCAGCTGG - Intergenic
1000984208 5:167849494-167849516 GTTCTCCAGTGGACACCAGCTGG + Intronic
1001909927 5:175507530-175507552 CATTACCAGTGGAGATGAGTAGG + Intronic
1002630844 5:180576225-180576247 AATTTCCAGTGAAGGTGAGCTGG + Exonic
1003656938 6:8020533-8020555 GATTTCCAGAGAAACTCAGCTGG - Intronic
1005310483 6:24554162-24554184 GCTTTGCAGTGGACACCAGCTGG - Intronic
1006746554 6:36346873-36346895 GATTTCAAGATGAGATCATCCGG + Intergenic
1006961808 6:37939434-37939456 GATTTCCAGATGAGATAATCCGG - Intronic
1011291364 6:85780680-85780702 GTTCTCCAGTGGACACCAGCTGG + Intergenic
1014127781 6:117796229-117796251 GATTTCCTATGCACATCAGCAGG + Intergenic
1014268435 6:119309193-119309215 CATTTCCAGAAGTGATCAGCTGG - Intronic
1015438462 6:133218799-133218821 GAGTTCAAGAGGAGAGCAGCAGG - Intergenic
1016244397 6:141965546-141965568 GATTTCCAGTGATGAGCAGCTGG + Intergenic
1016614499 6:146029898-146029920 GATTTCCATTCGAGATGAGAAGG + Exonic
1018011971 6:159678841-159678863 GTTGTCCAGTGGACACCAGCTGG - Exonic
1018801532 6:167226423-167226445 GAATTTCAGTGGAGTCCAGCTGG - Intergenic
1022789559 7:33673310-33673332 GATTTCCCAGGGAGATCTGCTGG - Intergenic
1023405130 7:39825946-39825968 GATGTCCAGTACAGAACAGCTGG + Intergenic
1024317909 7:48038484-48038506 AATTTGCAGTGCAGACCAGCAGG + Intronic
1029074363 7:97924492-97924514 GATTTCCATTTGAGCACAGCTGG - Intergenic
1031546198 7:123053721-123053743 GTGTTCCAGTGCAGATCATCAGG - Intergenic
1032671851 7:134091020-134091042 GATTTTCAGTTGAGATTAGGGGG + Intergenic
1033258976 7:139825906-139825928 GATTTCCAATGCATATTAGCAGG + Intronic
1034206635 7:149321817-149321839 GATTTCCAGTGGGGGTCCTCAGG + Intergenic
1036243343 8:7096798-7096820 GATTTCCATTTGAGCACAGCTGG + Intergenic
1036257469 8:7217269-7217291 GATTTCCATTTGAGCACAGCTGG - Intergenic
1036309515 8:7675865-7675887 GATTTCCATTTGAGCACAGCTGG - Intergenic
1036360022 8:8070254-8070276 GATTTCCATTTGAGCACAGCTGG + Intergenic
1036829386 8:12010394-12010416 GATTTCCATTTGAGCACAGCTGG - Intergenic
1036890940 8:12596716-12596738 GATTTCCATTTGAGCACAGCTGG - Intergenic
1036898485 8:12654632-12654654 GATTTCCATTTGAGCACAGCTGG - Intergenic
1038405551 8:27319964-27319986 GATTGCCAGTGAACACCAGCTGG + Intronic
1039074257 8:33674844-33674866 GTTTTCCAGTGGCAAGCAGCTGG + Intergenic
1039089161 8:33810053-33810075 CATTCCCAGTGGAGATCCCCAGG + Intergenic
1044404755 8:91815666-91815688 TATGTCCAGTGGGGATCAGCAGG + Intergenic
1056663038 9:88558726-88558748 GTTCTCCAGTGGACACCAGCTGG - Intronic
1057666648 9:97051088-97051110 GTTTTGCAGTGGACACCAGCAGG - Intergenic
1059577760 9:115509378-115509400 AATATCCAGTAGAAATCAGCGGG + Intergenic
1186762937 X:12742154-12742176 GATTTCCAGTTGAGAACCACTGG - Intergenic
1193024492 X:76830636-76830658 GAATTACAGTGGAGAACATCAGG + Intergenic
1195087318 X:101424577-101424599 GTTTTGCAGTGGACACCAGCTGG - Intronic
1199029606 X:142981293-142981315 GACTTCCAGTGGAGAAAATCAGG - Intergenic
1200300515 X:154969892-154969914 GAGTTCCAGAAGAGGTCAGCAGG - Intronic