ID: 954914457

View in Genome Browser
Species Human (GRCh38)
Location 3:54136898-54136920
Sequence AAACAGTGTCTCTCAAAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 372}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954914457_954914461 4 Left 954914457 3:54136898-54136920 CCACGCTTTGAGAGACACTGTTT 0: 1
1: 0
2: 3
3: 55
4: 372
Right 954914461 3:54136925-54136947 GTTGTCTCTGGGAAGGCTTCTGG 0: 1
1: 0
2: 4
3: 22
4: 279
954914457_954914459 -7 Left 954914457 3:54136898-54136920 CCACGCTTTGAGAGACACTGTTT 0: 1
1: 0
2: 3
3: 55
4: 372
Right 954914459 3:54136914-54136936 ACTGTTTACATGTTGTCTCTGGG 0: 1
1: 0
2: 4
3: 19
4: 208
954914457_954914460 -3 Left 954914457 3:54136898-54136920 CCACGCTTTGAGAGACACTGTTT 0: 1
1: 0
2: 3
3: 55
4: 372
Right 954914460 3:54136918-54136940 TTTACATGTTGTCTCTGGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 234
954914457_954914458 -8 Left 954914457 3:54136898-54136920 CCACGCTTTGAGAGACACTGTTT 0: 1
1: 0
2: 3
3: 55
4: 372
Right 954914458 3:54136913-54136935 CACTGTTTACATGTTGTCTCTGG 0: 1
1: 2
2: 2
3: 22
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954914457 Original CRISPR AAACAGTGTCTCTCAAAGCG TGG (reversed) Intronic
901926847 1:12571453-12571475 GAACAGTGGTTCTCAAAGTGAGG + Intronic
902735411 1:18397555-18397577 TAGCAGTGTTTCTCAAAGAGAGG - Intergenic
903488642 1:23710514-23710536 ACACAGTGGTTCTCAAAGCTTGG - Intergenic
904672093 1:32173679-32173701 AAACAGTGGCTCTCAAGCCTGGG - Exonic
904843633 1:33391212-33391234 AGACAGTGGTTCTCAAAGTGTGG - Intronic
905107083 1:35570363-35570385 GATCAGTGGCTCTCAAAGTGTGG - Intergenic
905400590 1:37699984-37700006 AGACAGTGTTTCTCAGAGTGCGG - Intronic
905937069 1:41833207-41833229 GAACAGTGGCTCTAAAAGTGGGG + Intronic
906973520 1:50544466-50544488 AAGCAATGTGTCTCAAAGTGTGG - Intronic
907176082 1:52523881-52523903 TACCAGTGTTTCTCAAAGTGTGG + Intronic
907441154 1:54479294-54479316 AGGCAGTGTCTCCCAAAGTGTGG - Intergenic
907928217 1:58974515-58974537 ACAAAGTGTCTCACAGAGCGTGG - Intergenic
907952585 1:59197868-59197890 GGACAGTGGCTCTCAAAGTGTGG - Intergenic
908609172 1:65836873-65836895 AAGCAGTGTCTCTCATAGGAAGG - Intronic
910474135 1:87588941-87588963 AAGCAGTGTTTCTCAAAGTGTGG + Intergenic
910731875 1:90406510-90406532 AAACAGTGGTTCTCAAATCTGGG + Intergenic
912992655 1:114504637-114504659 AAGCAGTGATTCTCAAAGTGTGG - Intronic
915044166 1:152997931-152997953 GATCAGTGTTTCTCAAAGTGTGG + Intergenic
915541747 1:156571882-156571904 AAACAGTGTCTTTGAAAATGTGG + Intronic
916800389 1:168210342-168210364 AAACAGTTTCTCTCAAGGGCAGG - Intergenic
916895259 1:169155884-169155906 GAACAGTGGCTCTCCAAGTGTGG + Intronic
919081305 1:192869486-192869508 GAACAGTGTTTCTCAATGTGTGG + Intergenic
921863821 1:220067773-220067795 AAACAGAGTTTCTCAAAGGGAGG + Intronic
924151176 1:241131504-241131526 AAACAGTAGTTCTCAAAGTGTGG - Intronic
924268882 1:242311475-242311497 AACCAGTGGTTCTCAAAGTGTGG - Intronic
1064329742 10:14382486-14382508 ACACAGTGTTTCTCAAAGAGTGG + Intronic
1064955972 10:20910543-20910565 AAACAGTGTCTCTCTGACCATGG - Intronic
1065423597 10:25575410-25575432 AAAGAGCGGCTCTCAAAGTGTGG + Intronic
1066716030 10:38287290-38287312 AACCAGTGGTTCTCAAAGTGTGG + Intergenic
1066719173 10:38319350-38319372 AAACAGTGATTCTCAAACCTGGG - Intergenic
1067190657 10:44065202-44065224 AAACTGTGCTTCTCAAAGTGGGG - Intergenic
1067740487 10:48891758-48891780 AAACAGTAGCTCTCAAAGTGTGG - Intronic
1068601916 10:58965682-58965704 AGACAGTGGTTCTCAAAGCATGG + Intergenic
1068893353 10:62171598-62171620 TAACAGTGGTTATCAAAGCGTGG - Intergenic
1069888909 10:71640892-71640914 AAACAGTGGTTCTCCAAGTGTGG - Intronic
1069924871 10:71842080-71842102 AACCAGTGGTTCTCAAAGTGTGG + Intronic
1070025693 10:72629429-72629451 AAACAGTGGTTCTCAAAGTGTGG - Intergenic
1070541978 10:77422380-77422402 GATCAGTGTTTCTCAAAACGGGG - Intronic
1070601039 10:77866395-77866417 AACCAGTGGCTCACAAAGCCTGG - Intronic
1070691192 10:78527543-78527565 ACACAGTGCTTCTCAAAGCATGG - Intergenic
1070695283 10:78558628-78558650 AATCAGTAGCTCTCAAAGTGTGG + Intergenic
1071120368 10:82269848-82269870 AATCCGTGTCTTTCAAAGTGTGG - Intronic
1072062924 10:91834667-91834689 AAGCAGTGTTTCTCAAAACGTGG - Intronic
1072475371 10:95755146-95755168 ATACAGTTTCTCTCACAGCATGG - Intronic
1075260449 10:120958831-120958853 AACCAGTGGTTCTCAAAGTGTGG + Intergenic
1075433494 10:122411523-122411545 GAGCAGTGTTTCTCAAAGTGTGG + Intronic
1076170012 10:128311440-128311462 AGACAGTCTCTCTCAAAGCAGGG - Intergenic
1078155374 11:8795372-8795394 AAGCAGTGGTTCTCAAAGTGGGG + Intronic
1079551737 11:21707535-21707557 ACACAGTGATTCTCAAAGTGTGG - Intergenic
1080934086 11:36843412-36843434 GAACAGTGTTTCTCAAAGTGTGG - Intergenic
1081684253 11:45030456-45030478 AAACAGTGGTTCTCAAAGTGAGG + Intergenic
1081762520 11:45586364-45586386 GATCAGTGTTTCTCAAAGTGTGG - Intergenic
1081930986 11:46871289-46871311 AAGGAGTGGCTCTCAAAGAGTGG - Intronic
1082124854 11:48420432-48420454 AAACTGTGTCTATCAAAGAAAGG - Intergenic
1082251195 11:49982291-49982313 AAACTGTGTCTATCAAAGAAAGG + Exonic
1082558513 11:54591668-54591690 AAACTGTGTCTATCAAAGAAAGG - Intergenic
1084901956 11:72316320-72316342 ACACAGTGGTTCTCAAAGCATGG - Intronic
1085082290 11:73645241-73645263 AAACAAAGTCTCTCACAGCCAGG + Intergenic
1086168847 11:83812588-83812610 AAACAGTGAATCTCAAATGGTGG - Intronic
1086811999 11:91321800-91321822 AAACAGTGTTTCTCCCAGCATGG - Intergenic
1087140372 11:94759906-94759928 AACCAGTGGTTCTCAAAGTGTGG + Intronic
1087896560 11:103592970-103592992 GAACAGTGTTTCTTAAAGTGTGG - Intergenic
1089583587 11:119496428-119496450 CAACAGTGGTTCTCAAAGTGTGG - Intergenic
1089618393 11:119708269-119708291 AAAGAGTGTCTTTAAAAGCTTGG + Intronic
1089882865 11:121791733-121791755 AATCAGTGGCTCTCAAAGCACGG - Intergenic
1090035380 11:123245457-123245479 AAACAGTGGTTCTCAAAGTGTGG + Intergenic
1090144226 11:124302443-124302465 ATACAGTGTTTCTCAAATTGTGG - Intergenic
1091666274 12:2420618-2420640 CCACAGTGTCTCTCTAAGCAAGG + Intronic
1092674988 12:10906392-10906414 TTACAGTGTCTTTCAAAGAGAGG - Intronic
1092768927 12:11878872-11878894 AAACCGTGTTTCTCTAAGCAGGG + Intronic
1092786592 12:12032388-12032410 AAATAGTGGTTCTCAAAGTGTGG + Intergenic
1093014515 12:14142913-14142935 AAACAGGGTCTCTTGAAGCTGGG - Intergenic
1093756623 12:22860055-22860077 GAACAGTGCTTCTCAAAGTGTGG + Intergenic
1093793216 12:23279496-23279518 AAGCAGCGTTTCTCAAAGTGCGG - Intergenic
1094059085 12:26294345-26294367 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1094221060 12:27994142-27994164 ACGCAGTGTTTCTCAAAGTGTGG + Intergenic
1094293479 12:28877836-28877858 AAAAAATGTGTCTCAAAGGGTGG - Intergenic
1094329545 12:29275940-29275962 GAACAGTGGTTCTCAAAGTGTGG + Intronic
1094497226 12:30995894-30995916 AAGCAGTGGTTCTCAAAGTGTGG - Exonic
1094649663 12:32363011-32363033 AGACAGGGTCTCTTAAAGCCTGG - Intronic
1095583457 12:43825852-43825874 AGTCAGTGTTTCTCAAAGTGTGG - Intergenic
1096249507 12:50019983-50020005 AAACAGTGATTCTCAAATCTAGG + Intronic
1097286441 12:57880891-57880913 ATGCAGTGTTTCCCAAAGCGGGG - Intergenic
1097318359 12:58197463-58197485 AAAGAGTGTCTCTAACAGCTGGG - Intergenic
1098586448 12:72160250-72160272 AGTCAGTGGCTCTCAAAGTGTGG + Intronic
1099072350 12:78061039-78061061 AAACAGTGCCTCTTAAAGTGTGG + Intronic
1099806096 12:87521189-87521211 AACCAGTGGCTCTCAAACAGGGG + Intergenic
1099987575 12:89685478-89685500 AATCAGTGACTCTCAAAGTATGG + Intronic
1100832940 12:98535104-98535126 AAGAAGTGTTTCTCAAAGTGTGG - Exonic
1101078686 12:101159017-101159039 AAATTGTGTATCTCAAAGAGTGG + Intronic
1103224267 12:119273702-119273724 AAATAGTGTTTCTCAAAGACTGG - Intergenic
1103645290 12:122387211-122387233 ATACAGTGGTTCTCAAAGTGTGG + Intronic
1103702360 12:122854570-122854592 ACACAGTGGTTCTCAAAGTGCGG - Intronic
1104216122 12:126735665-126735687 GAACAGTGATTCTCAAAGTGAGG - Intergenic
1104423558 12:128656709-128656731 ACACAGTGGTTCTCAAAGTGTGG - Intronic
1104530758 12:129568899-129568921 AAGCAGTGACTCTCAAACCCTGG + Intronic
1106554290 13:30796880-30796902 AAACACCGTCTCTCGAAGCTGGG + Intergenic
1107726380 13:43303896-43303918 GAGCAGTGGCTCTCAAAGTGTGG - Intronic
1107847462 13:44531639-44531661 AACCAGTGTTTCTCAAATTGGGG + Intronic
1108695856 13:52901738-52901760 ATACAGTGGTTCTCAAAGTGTGG + Intergenic
1109096194 13:58119909-58119931 ACCCAGTGTTTCTCAAAGTGTGG - Intergenic
1109883975 13:68518328-68518350 GAAGAGTCTCTCTCAAAGCAAGG - Intergenic
1110792041 13:79597088-79597110 GAACAGTGCTTCTCAAAGTGTGG - Intergenic
1111824640 13:93252208-93252230 AGACAGTGGTTCTCAAAGTGTGG - Intronic
1111913971 13:94341983-94342005 AAACAGTGTTTCTCAAAGTAGGG + Intronic
1111980735 13:95012835-95012857 CAACAGTGACGCTCAAAGCATGG - Intergenic
1112781369 13:102904491-102904513 ACACAGTGTGTCTCAAAGTCTGG - Intergenic
1113774398 13:112934591-112934613 AACCAGTGGTTCTCAAAGTGGGG - Intronic
1113779261 13:112966807-112966829 CAGCAGTGTTTCTCAAAGTGTGG + Intronic
1115200928 14:30853433-30853455 AAGCAGTGTTTCTCAAAGTTTGG + Intergenic
1116588652 14:46742602-46742624 GAACAGTGGTTCTCAAAGTGTGG - Intergenic
1117004728 14:51409055-51409077 AAACTGTCTCTCTCAAACTGTGG - Intergenic
1117070157 14:52048944-52048966 AAACTGTATTTCTCAAAGTGTGG - Intronic
1117235226 14:53767529-53767551 GAACAGTGATTCTCAAAGTGTGG + Intergenic
1117268538 14:54116579-54116601 AAACAATGGTTCTCAAAGTGTGG + Intergenic
1117331774 14:54719525-54719547 AAACAGTGTGTCACAAAGAAGGG - Intronic
1117644481 14:57837237-57837259 TAACAGTGTCTCTTGAAGTGTGG - Intronic
1117710524 14:58524520-58524542 AATCAGTGTTTCTCAAAGGGTGG - Intronic
1118611426 14:67543460-67543482 AGACAGTGATTCTCAAAGTGTGG + Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1119131811 14:72179734-72179756 TAACAGTGATTCTCAAAGTGTGG + Intronic
1119924089 14:78475007-78475029 CAACAGTGTATATCAAAGTGTGG - Intronic
1120040161 14:79743612-79743634 AAAAAGTGTTTCTCAAAGTATGG - Intronic
1120593243 14:86401359-86401381 AAACAGTTTTTTTCAAAGGGAGG - Intergenic
1121747602 14:96311259-96311281 GAACAGTGTAACTCAAAGCGGGG + Exonic
1122301826 14:100735751-100735773 TAACTGTGTTTCTCAAAGTGGGG + Exonic
1124553743 15:30707253-30707275 GAACAGTGGTTCTCAAAGTGAGG - Intronic
1124677505 15:31698421-31698443 GAACAGTGGTTCTCAAAGTGAGG + Intronic
1125090371 15:35783885-35783907 AAACAGTGTTTCTCAAAGTATGG - Intergenic
1126417606 15:48434037-48434059 GAGCAGTGGCTCTCAAAGGGTGG - Intronic
1126866392 15:52941703-52941725 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1127643221 15:60934704-60934726 ATACAGTGGTTCTCAAAGTGTGG - Intronic
1129135947 15:73551368-73551390 GAACAGTGGTTCTCAAAGTGTGG + Intronic
1130665269 15:85864138-85864160 AAACAATGGTTCTCAAAGCATGG + Intergenic
1130905729 15:88239851-88239873 CAACAGTCACTCTCAAAGTGTGG + Intronic
1131754337 15:95543826-95543848 AAGCAGTGGCTCTCAAAGTCTGG + Intergenic
1133967212 16:10540071-10540093 GAACAGGGTTTCTCAAAGCTGGG + Intronic
1134876974 16:17709312-17709334 GAACAGTGGCTCTCAAAGTATGG + Intergenic
1134908209 16:18000276-18000298 AAACAATGGTTCTCAAAGTGTGG + Intergenic
1134914939 16:18061591-18061613 CAGCAGTGGTTCTCAAAGCGTGG + Intergenic
1135139848 16:19912039-19912061 AGCCAGTGTTTCTCAGAGCGTGG - Intergenic
1135249306 16:20887450-20887472 AATCACTGTTTCTCAAAGTGTGG - Intronic
1135984933 16:27177124-27177146 AATCAGTGTTTCTCAAAGCATGG + Intergenic
1136098395 16:27975140-27975162 AAGGAGTGGCTCTCAAAGTGTGG - Intronic
1136291303 16:29273211-29273233 AAGCAGTGGTTCTCAAAGTGTGG - Intergenic
1136490970 16:30608207-30608229 CAGCAGTGGTTCTCAAAGCGTGG - Intronic
1137883672 16:52079116-52079138 AAACAGTGTCTTTGTAAGAGGGG + Intergenic
1138346140 16:56321413-56321435 AAAGAGAGGCTCTCAAAGGGAGG - Intronic
1138723787 16:59113394-59113416 AATTAATGTCTCTCAAAGGGAGG + Intergenic
1138911174 16:61401054-61401076 AAACAGTGGTTCTCAAAGTGCGG + Intergenic
1139158128 16:64469020-64469042 AATCACTGTTTCTCAAAGTGAGG - Intergenic
1139354359 16:66358538-66358560 AGACAGTGGTTCTCAAAGTGTGG - Intergenic
1141813893 16:86396257-86396279 GAACAGTGTCTCTTCAAGCTTGG + Intergenic
1143270896 17:5673671-5673693 GACCAGTGGCTCTCAAAGTGTGG - Intergenic
1143834630 17:9680716-9680738 AAATAGTGGTTCTCAAAGTGTGG - Intronic
1144040691 17:11408273-11408295 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1144814536 17:18024840-18024862 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1146550741 17:33778378-33778400 AAAAGGTGTTTCTCAAAGCCTGG - Intronic
1148037754 17:44680912-44680934 AAACAGTGGTTCTCAAAGTGTGG + Intronic
1149543091 17:57483510-57483532 CAGCAGTGGTTCTCAAAGCGTGG - Intronic
1149867489 17:60158768-60158790 AAACAGTGGTTCTCAAAGTGCGG + Intronic
1151011610 17:70504473-70504495 AACCAGTGGTTCTCAAAGTGTGG + Intergenic
1151134207 17:71929840-71929862 AAACAGTGTCTTTCAAAAGAGGG + Intergenic
1152632224 17:81415390-81415412 AAACTCTGTGTCTCAAGGCGTGG - Intronic
1153479636 18:5534351-5534373 AGACAGTGTGTCTCAAAATGTGG + Intronic
1153947522 18:10030846-10030868 GAACAGTGGTTCTCAAAGTGGGG - Intergenic
1155456979 18:26027981-26028003 AAATAGTGTCTTTCAAAGACAGG - Intronic
1155518487 18:26645755-26645777 AAACAGAGGTTCTCAAAGTGCGG + Intronic
1156038073 18:32788582-32788604 AGGCAGTGTTTCTCAAAGTGTGG + Intergenic
1156368894 18:36454854-36454876 AACCGGTGTCTCTGAAAGCTGGG - Intronic
1156469254 18:37367270-37367292 AAACAGTGTTAGTCAAAGAGAGG + Intronic
1157315985 18:46590112-46590134 ACACAGTGGTTCTCAAAGTGTGG + Intronic
1158102002 18:53840294-53840316 AAACAGTGTTTCTCAACCAGGGG - Intergenic
1158842746 18:61405666-61405688 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1158902007 18:61972768-61972790 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1158952654 18:62509311-62509333 AATCAGTGTCTTACAAAGAGTGG + Intergenic
1161621060 19:5297355-5297377 AAACAGTTTCTCTCTAGGCGAGG - Intronic
1161688478 19:5716467-5716489 AAACACTGGCTCTCAAAGGATGG - Intronic
1164228042 19:23263349-23263371 AGATAGTGTCTCTCACAGCTAGG - Intergenic
1165734315 19:38166113-38166135 TACCAGTGGCTCTCAAAGTGTGG - Intronic
1166414481 19:42583810-42583832 AAACAGAGTCTCACAAAACTGGG - Intronic
925774528 2:7321263-7321285 AAGCAGTGGTTCTCAAAGAGAGG - Intergenic
927014086 2:18938446-18938468 AAACAGTGTCTCAAAAAGAGAGG + Intergenic
927338090 2:21948520-21948542 GAGCAGTGGCTCTCAAAGGGTGG + Intergenic
928726398 2:34178871-34178893 TAACAGTGGTTCTCAAAGCATGG - Intergenic
928946453 2:36776209-36776231 AACCAGTGGTTCTCAAAGTGTGG + Intronic
928973403 2:37056585-37056607 AAACAGTGCCTCTGGAAGTGGGG - Exonic
928995293 2:37283187-37283209 ACACAGTGGCTCTCAAACTGTGG + Intronic
929254335 2:39793024-39793046 AAACAGTGCCTGTCATAGAGTGG - Intergenic
929904403 2:46033559-46033581 AGGCAGTATTTCTCAAAGCGTGG - Intronic
930827823 2:55712005-55712027 AAACAGAGTCTCGCCAGGCGCGG - Intergenic
930864857 2:56112335-56112357 AAACAGTGGTTCTTAAAGCCTGG + Intergenic
931123033 2:59241743-59241765 GAGCAGTGTTTCTCAAAGTGTGG - Intergenic
931580770 2:63770618-63770640 ATACAGTGGTTCTCAAAGTGTGG + Intronic
931670025 2:64639185-64639207 AAATAGTGTTTCTCAAAGTGTGG + Intronic
932733155 2:74234723-74234745 GAACAGTGATTCTCAAAGTGTGG - Intronic
932963955 2:76448572-76448594 AAACACTGTTTATCAAAGTGAGG - Intergenic
935813555 2:106824937-106824959 AAAGAATGGTTCTCAAAGCGTGG + Intronic
937233201 2:120414067-120414089 AATCAGTGTTGCTCAAAGTGGGG - Intergenic
937629242 2:124081259-124081281 AAAGAGTGTTTCCCAAAGGGTGG - Intronic
937774468 2:125759513-125759535 AAACAGTGGCACACAAAGCAAGG - Intergenic
938242680 2:129755515-129755537 AAACAGTGGTTCTCAAAGTGTGG + Intergenic
941432189 2:165426479-165426501 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
941477785 2:165969902-165969924 AAGCAGTGGCTTTCAAAGTGTGG - Intergenic
941633990 2:167915599-167915621 AAGCAGTGACCCTCAAAGTGTGG + Intergenic
941659543 2:168181762-168181784 AAATACTGTTTCTCAAAGCAAGG + Intronic
941850268 2:170173282-170173304 AAGCAGTGTTTCTCAAAGGGTGG + Intergenic
942898527 2:181087331-181087353 AAGCAGTGTTTCTTAAAGTGTGG + Intergenic
943619101 2:190127805-190127827 AAACAGTGTTTCCCAAAGCATGG + Intronic
944341783 2:198609987-198610009 GAACAATGACTCTCAAAGCATGG - Intergenic
944761653 2:202821725-202821747 AATCAGTCCTTCTCAAAGCGAGG - Intronic
945509907 2:210687890-210687912 AAACTCTGTCTCTCAAAGGGAGG + Intergenic
946124420 2:217549624-217549646 TAACAGTGTCTTTTAAAGTGTGG - Intronic
947328826 2:229006815-229006837 TAACAGTGGTTCTCAAAGTGTGG - Intronic
948494016 2:238333682-238333704 AGACAGTGTTTCTCAAAGTGTGG + Intronic
1169664424 20:8019117-8019139 AAACACTGTCCCCCAAAGCAAGG + Intronic
1170459661 20:16565472-16565494 AAACAGTGATTCTCCAAGTGTGG - Intronic
1170906783 20:20523201-20523223 TAACAGTGTCTCTCAAACCTTGG - Intronic
1172432240 20:34901872-34901894 GACCAGTGTTTCTCAAAGAGTGG - Intronic
1172557658 20:35856495-35856517 AACCAGTGCTTCTCAAAGTGTGG - Intronic
1173299715 20:41791244-41791266 AAGCAGTGGTTCTCAAAGTGAGG + Intergenic
1173300759 20:41800340-41800362 AAGCACTGTCTCTCAATGAGAGG + Intergenic
1173942526 20:46923849-46923871 AAACAGTATTTCTCAAAACATGG + Intronic
1174043563 20:47717196-47717218 AACCAGTGGCTCTCAAAGCGTGG - Intronic
1178212788 21:30556865-30556887 AGACAGAGTCTTTCAAAGCAGGG + Intronic
1178385565 21:32146317-32146339 AAGCAGTGTTTGTCAGAGCGTGG + Intergenic
1180611208 22:17099399-17099421 AAGCAGTGGGTCTCAAAGTGTGG + Intronic
1180678692 22:17607698-17607720 AAACACTATTTCTCAAAGTGTGG + Intronic
1181825387 22:25511160-25511182 AACCAGTGATTCTCAAAGTGTGG - Intergenic
1181856789 22:25787432-25787454 CAACAGTGGTTCTCAAAGCGGGG - Intronic
1181895373 22:26102667-26102689 ATTCAGTGGCTCTCAAAGTGTGG - Intergenic
1182494544 22:30696519-30696541 AAACAGTGCTTCTCAGAGTGTGG - Intronic
1182920631 22:34075914-34075936 AAGCAGTGACTCACAAAGTGAGG - Intergenic
1184304413 22:43586720-43586742 AAACAGTGGTTCTCAAGGTGGGG + Intronic
949325437 3:2858170-2858192 AAACAGTGTTTCTCAGAGTGTGG + Intronic
949388276 3:3530078-3530100 TAACAGTGGTTCTCAAAGCGTGG + Intergenic
949790756 3:7789569-7789591 GAACAGTGGTTCTCAAAGCGTGG - Intergenic
949958509 3:9290582-9290604 AAGTAGTGTTTCTCAAAGTGTGG + Intronic
950039611 3:9911437-9911459 AAACAGGGTCTCTCACATCCTGG + Exonic
950282225 3:11718711-11718733 AGACAGTGCCTTTCAAAGAGAGG + Intronic
951055911 3:18146127-18146149 GATCAGTGTCTCTTAAAGTGTGG + Intronic
951281638 3:20757418-20757440 AACCAGTGTTTCTTAAAGTGTGG - Intergenic
952156664 3:30650702-30650724 GAGCAGTGTTTCTCAAAGTGCGG + Intronic
952164130 3:30727882-30727904 AAGCAGTGGTTCTCAAAGTGTGG - Exonic
952529558 3:34249252-34249274 AAGTAGTGGCTCTCAAAGTGTGG + Intergenic
952836379 3:37605797-37605819 CATCAGTGTCTCTCTAAGGGAGG + Intronic
952849334 3:37714626-37714648 CATCAGTGCCACTCAAAGCGTGG + Intronic
953227881 3:41036969-41036991 GATCAGTGTTTCTCAAAGTGAGG + Intergenic
953326463 3:42015544-42015566 AAACATTGTCTCCCAGAGAGGGG - Intronic
953781898 3:45878611-45878633 TAACAGTGTCTTTCATAGAGGGG - Intronic
954914457 3:54136898-54136920 AAACAGTGTCTCTCAAAGCGTGG - Intronic
956363985 3:68480027-68480049 AAGCATTGGCTCTCAAAGTGTGG + Intronic
956933059 3:74068052-74068074 GAACAGTGGTTCTCAAAGTGTGG + Intergenic
958599959 3:96284505-96284527 AAGCAGTGTCTCCCAGAGTGTGG - Intergenic
959525850 3:107375647-107375669 AGGCAGTGGCTCTCAAAGTGTGG + Intergenic
959915631 3:111814085-111814107 AAACAGTGTATTCCAAAACGTGG + Intronic
960113886 3:113873384-113873406 ATACAGTGGTTCTCAAAGTGTGG + Intronic
960891296 3:122451187-122451209 AAACAGTGGTTCTCAAAGTGTGG - Intronic
961061824 3:123835106-123835128 GAGCAGTGTTTCTCAAAGTGTGG + Intronic
961429689 3:126872542-126872564 AAACAGTGTTTCTCAAAGGTGGG - Intronic
961960121 3:130845852-130845874 AACCAGTGGCTCTCAAAGTGAGG + Intergenic
962106864 3:132399270-132399292 AAACAGTATTTCTCAGAGCAGGG + Intergenic
962425031 3:135262161-135262183 ATACAGTGGTTCTCAAAGCATGG - Intergenic
962983247 3:140509456-140509478 GAACAGTGGTTCTCAAAGTGTGG - Intronic
964127436 3:153250068-153250090 AAGCAGTGTTTCCCAAAGCATGG + Intergenic
964614664 3:158649908-158649930 GATCAGTGTCACTCAAAGTGTGG - Intronic
964801105 3:160558646-160558668 AAAGAGTGGCACTCAAAGCATGG + Intronic
964920702 3:161891977-161891999 AATCAGTGTCTCTGAAGGCGTGG - Intergenic
966648609 3:182274083-182274105 AATCAGTGGTTCTCAAAGTGTGG - Intergenic
967017328 3:185494063-185494085 GAGCAGTGTTTCTCAAAGTGTGG - Intronic
967576118 3:191095981-191096003 AAACAGTGCTACTCAAAGTGTGG - Intergenic
969948683 4:10811335-10811357 AAGCAGTGATTCTCAAAGCAGGG - Intergenic
970776885 4:19685344-19685366 AAACATTGTCTGACAAAGGGAGG + Intergenic
970873872 4:20847324-20847346 AACCAGTGATTCTCAAAGTGTGG + Intronic
972170801 4:36343103-36343125 AAACAGTGCTACTCAAAGCATGG + Intronic
972308063 4:37851321-37851343 AAACAGTGGTTCTCAAAGTGAGG - Intronic
972427700 4:38949827-38949849 AATCAGTGTCTCACAGAGCTTGG - Intergenic
973246529 4:48016494-48016516 CAACAGCGTCTCTCGGAGCGTGG - Intronic
973575869 4:52288753-52288775 GAGCAGTGGCTCTCAAAGAGTGG - Intergenic
973615973 4:52678211-52678233 AGACAGTGTTTCTCAAAGTATGG - Intergenic
973779620 4:54276259-54276281 AATCAGTGTCTCTGAAACTGGGG - Intronic
973779624 4:54276309-54276331 AATCAGTGTCTCTGAAACTGGGG - Intronic
974939561 4:68449531-68449553 AAGCACTGTCTCTAAAAGTGTGG + Intronic
977498067 4:97802117-97802139 AAACAGTGTTTCTCAAAGTGTGG - Intronic
977777340 4:100936772-100936794 ATAAAGTGTCTCTCAAAGTAAGG + Intergenic
977898457 4:102391638-102391660 AAACAGTGATACTCAAAGTGTGG - Intronic
979471726 4:121107059-121107081 AAGCAATGGCTCTCAAAGCACGG - Intergenic
980834302 4:138172518-138172540 AATCAGTGATTCTCAAAGTGCGG + Intronic
981239346 4:142457307-142457329 CAACAGTGTCTTTCACAGAGTGG - Intronic
981558774 4:146024385-146024407 AATCAGTGTCTGTCACAGAGGGG - Intergenic
983914738 4:173280008-173280030 AATCAGTGTTTCTCAAATTGAGG + Intronic
984146880 4:176072472-176072494 AATCAGTGTATCTCAAAGTGTGG - Intronic
984376098 4:178931932-178931954 AGACATTGTCTCTCAAATGGTGG + Intergenic
987087237 5:14482287-14482309 GAACAGTGGTTCTCAAAGTGTGG - Intronic
989024111 5:37045722-37045744 AAACAGTGCTGCTCAAAACGTGG + Intronic
990380282 5:55216230-55216252 CAACAGTGGGTCTCAAAGTGTGG + Intergenic
990460252 5:56024892-56024914 ATCCAGTGTTTCTCAAAGGGTGG + Intergenic
991068554 5:62451583-62451605 AAACAGTGGTTCTCAAAGTGTGG - Intronic
991172534 5:63645606-63645628 AAATAGTGTTTCTCAAACCTTGG + Intergenic
992006266 5:72480914-72480936 ATACAGGGGCTCTTAAAGCGTGG - Intronic
993425075 5:87753136-87753158 AACCAGTGATTCTCAAAGTGGGG - Intergenic
994759926 5:103839231-103839253 AGGCATTGTCTCTCAAAGCCTGG + Intergenic
994782070 5:104102923-104102945 GTACAGTGCTTCTCAAAGCGTGG - Intergenic
995385994 5:111589596-111589618 AAACAGTGATTCTCAAAGTATGG + Intergenic
996373473 5:122777141-122777163 AAACAGTGCTTCTCAAACTGTGG + Intronic
998867138 5:146516664-146516686 AAACAGTGGTTCTCAAAGTGTGG - Intergenic
999529244 5:152444110-152444132 AATCAGTGTTTTTCAAAGCTTGG + Intergenic
999718022 5:154377589-154377611 AACCAGTGCTTCTCAAAGTGTGG - Intronic
1000744837 5:165019792-165019814 AAACAGTTGTTCTCAAAGTGTGG - Intergenic
1001083311 5:168682543-168682565 AACCAGTGGTTCTCAAAGCGTGG - Intronic
1001719487 5:173845085-173845107 AAAAAATGTCTCTCAAAACATGG + Intergenic
1001756931 5:174177640-174177662 AACCAGTGCTTCTCAAAGTGAGG + Intronic
1001847623 5:174935983-174936005 AAACATTCACTCTCAAAGCCTGG + Intergenic
1002916934 6:1536980-1537002 AAACAGAGTCTCTGAAAACGTGG - Intergenic
1003124186 6:3342495-3342517 AAACAGTGCTTCTCAAAGGTGGG + Intronic
1003562898 6:7198030-7198052 GCACAGTGTCTCTGAAAGCAGGG + Intronic
1003600165 6:7509795-7509817 GAACAGTGGTTCTCAAACCGGGG + Intergenic
1004008768 6:11661038-11661060 ACACAGTATCTTTCAAAGAGTGG + Intergenic
1004200171 6:13541100-13541122 AGACAGTGGTTCTCAAAGTGTGG + Intergenic
1004761346 6:18669954-18669976 AAACAGTGTCTCCAAAATAGAGG - Intergenic
1005127567 6:22465525-22465547 AGTCAGTGTTTCTCAAAGTGTGG - Intergenic
1007189430 6:40000726-40000748 AAACAATGCTTCTCAAAGTGTGG - Intergenic
1009658032 6:66570750-66570772 GAACAGTGATTCTCAAAGTGTGG + Intergenic
1011431383 6:87290475-87290497 AAACAGTGTTTCCCAAACCCAGG + Intronic
1011507293 6:88059778-88059800 AACCAGTGGTTCTCAAAGTGTGG - Intronic
1011727572 6:90225918-90225940 AAGCAGTGGTTCTCCAAGCGGGG + Intronic
1011826146 6:91308000-91308022 AATCAGTATTTCTCAAAGTGTGG + Intergenic
1012915241 6:105162869-105162891 AGACAGTATCCCTCAAAGGGTGG - Intronic
1014457366 6:121651520-121651542 ACACAGTGCCTCTCCAAGAGAGG - Intergenic
1015115681 6:129646893-129646915 AAACAGTGGTTTTCAAAGCGTGG - Intronic
1015617765 6:135096023-135096045 AAACAGTGTCTCACACACTGAGG + Intronic
1015619153 6:135112044-135112066 CAGCAGTGACTCTCAAAGTGTGG + Intergenic
1015876481 6:137827939-137827961 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1017540567 6:155398293-155398315 TGACAGTGTTTCTCAAAGTGAGG - Intronic
1018116410 6:160590202-160590224 ACACATTGTCTCTCAGAGAGGGG + Intronic
1018858830 6:167696068-167696090 CAGCAGTGTTTCTCAAAGCATGG - Intergenic
1021094357 7:16518515-16518537 AAACAGGGTCTCTCACAGAAGGG + Intronic
1021406424 7:20272616-20272638 AAACAGTGGCTCTCAATAGGAGG + Intergenic
1021669681 7:23022939-23022961 AAACAGTTTCTCTGAAAATGTGG + Intergenic
1021999416 7:26210938-26210960 AACCAGTGGCTCTCAAAATGTGG - Intronic
1022396948 7:29997581-29997603 AATCAGTGTTTCTCAAATAGGGG + Intergenic
1022834698 7:34102508-34102530 AACCAGTGGTTCTCAAAGTGTGG - Intronic
1022970762 7:35514622-35514644 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1023270042 7:38452738-38452760 AAACAGTGGCTCCCACAGTGTGG + Intronic
1025009219 7:55382517-55382539 AATCAGTGTCTCTGAAAACTTGG + Intronic
1025985941 7:66451883-66451905 AGACAGTGGTTCTCCAAGCGTGG + Intergenic
1026146708 7:67752768-67752790 AAACAGTAGTTCTCAAAGTGTGG - Intergenic
1026326817 7:69317719-69317741 AAACAGTGATTCTCAAAGTAGGG + Intergenic
1026375602 7:69747220-69747242 GAGCAGTGGTTCTCAAAGCGTGG - Intronic
1026448960 7:70510454-70510476 ACACAGTGGTTCTCAAAGAGTGG + Intronic
1026450066 7:70520911-70520933 AAAGATTGTTTCTCCAAGCGTGG - Intronic
1026628276 7:72015797-72015819 TAACAGTGGTTCTCAAAGTGTGG - Intronic
1027421449 7:78020681-78020703 GACCAGTGTTTCTCAAAGCTTGG - Intronic
1027809749 7:82880542-82880564 AAGCAGTGGCTCTCAAATGGGGG + Intronic
1028714755 7:93952520-93952542 AAGCAGTGGTTCTCAAAGCATGG - Intergenic
1030803953 7:113890210-113890232 AAACAGTGCCTCTCAAAATGTGG + Intronic
1031235962 7:119176948-119176970 AAACAGCTTTTCTCAAAGTGTGG + Intergenic
1031416269 7:121500087-121500109 AATCAGTGGTTCTCAAAGTGTGG + Intergenic
1031844989 7:126794699-126794721 AAACGGTGTTTGTCAAAGTGTGG + Intronic
1038156050 8:24991638-24991660 AAGCAGTGTCTCCCCAAGCAGGG + Intergenic
1038318311 8:26506833-26506855 GTACAGTGTCTCACAAAGCCAGG + Exonic
1038436881 8:27542555-27542577 AGACAAAATCTCTCAAAGCGTGG + Intronic
1038552519 8:28482277-28482299 AAATAGTGCCTCTCATAGCGGGG + Intronic
1038901569 8:31850165-31850187 AAGCAGTATCTCTCCAAGCTGGG + Intronic
1039236251 8:35505763-35505785 ACTTAGTGTATCTCAAAGCGGGG - Intronic
1039826085 8:41175294-41175316 AACCAGTGTTTCTCCAAGCGTGG - Intergenic
1039872762 8:41560758-41560780 AAAAAGTGCCTCTCAATGTGAGG - Intergenic
1040488513 8:47897587-47897609 AAGCAGTGCTTCTCAAAGTGTGG + Intronic
1040907271 8:52481240-52481262 GAACTGTGTATCTCAAAGTGTGG - Intergenic
1042452315 8:68962210-68962232 AAACAGTGTTCCTTAAAGGGTGG - Intergenic
1043166379 8:76908115-76908137 AATCTGTGTCTCTCAAGGCCTGG + Intergenic
1043865274 8:85367704-85367726 AAGCAGTGGCTCTCTAAGTGTGG - Intronic
1044886501 8:96783948-96783970 AAACAGTGCTACTCAAAGCATGG - Intronic
1045013017 8:97975005-97975027 AAACATTGGTTCTCAAAGTGTGG - Intronic
1045144814 8:99330013-99330035 AAACAGTGACTCTCAAACAGGGG - Intronic
1045438552 8:102188090-102188112 AGACAGTGTTTGTCAAAGCTTGG - Intergenic
1045906356 8:107349943-107349965 AATCAGTGCATCTCAAAGTGTGG + Intronic
1046099471 8:109597969-109597991 AAACAGTGACTCTCAAAGAGTGG - Intronic
1047046461 8:121058336-121058358 AATCAGAGTTTCTCAAAGTGTGG - Intergenic
1047982390 8:130196715-130196737 AAACAGTTTCTCTGAAAGTAAGG + Intronic
1048122777 8:131600272-131600294 AAACAGAGTATCTCAAAAAGAGG - Intergenic
1048488431 8:134869815-134869837 AAACAGTGATTCTCCAAGTGTGG + Intergenic
1050065230 9:1752318-1752340 AAAAACTGTCTCTCAAACCACGG + Intergenic
1050109155 9:2196873-2196895 AACCAGTGTTTCTCAGAGTGTGG + Intergenic
1050656911 9:7838954-7838976 AAACAGTGATTCTCAAAGTATGG + Intronic
1051279222 9:15424681-15424703 CAACAGTGCCTCTCAAAGAGTGG - Intronic
1051786008 9:20744323-20744345 ATCCAGTGTTTCTCAAAGCCTGG - Intronic
1053422874 9:37991329-37991351 ACGCAGTGTCCCTGAAAGCGTGG - Intronic
1053437257 9:38084253-38084275 AACCAGAGTTTCTCAAAGTGGGG - Intergenic
1053602937 9:39629164-39629186 AAACTGTGTTTCTCCAAGTGTGG - Intergenic
1053860586 9:42382912-42382934 AAACTGTGTTTCTCCAAGTGTGG - Intergenic
1054250600 9:62713272-62713294 AAACTGTGTTTCTCCAAGTGTGG + Intergenic
1054564708 9:66747784-66747806 AAACTGTGTTTCTCCAAGTGTGG + Intergenic
1054828708 9:69599631-69599653 AAACAGTGGTTCTCAAAGTGTGG + Intronic
1055195906 9:73593241-73593263 AGGCAGTGTTTCTCAAAGTGTGG - Intergenic
1055400474 9:75918456-75918478 AATCAGTGGCTCTCAAAGTGTGG - Intronic
1057599744 9:96447678-96447700 AAGCAGTGCTTCTCAAAGTGTGG + Intergenic
1057897238 9:98919111-98919133 ACATAGTGGCTCTCAAAGTGTGG - Intergenic
1057960828 9:99455095-99455117 AACCAGTGGTTCTCAAAGTGTGG - Intergenic
1058507059 9:105676784-105676806 AAAAAGTGTCTCACAAAGAGGGG - Intergenic
1059393360 9:114014856-114014878 ACACAGTGCTTCTCAAAGTGCGG - Intronic
1060231024 9:121825334-121825356 AAACAGCGCCACTCAAAGTGTGG + Intronic
1062678699 9:137764079-137764101 AACCAGTGGTTCTCAAAGTGTGG - Intronic
1186347900 X:8713364-8713386 AAGCAGTGACTTTCAAAGTGTGG + Intronic
1186572253 X:10727585-10727607 AAGCAGTGATTCTCAAAGTGTGG + Intronic
1186734319 X:12445157-12445179 GAGCAGTGTTTCTCAAAGAGTGG + Intronic
1186996401 X:15128201-15128223 TAACAGTGGTTCTCAAAGTGTGG + Intergenic
1187421049 X:19133964-19133986 ATACAATGGCTCTCAAAGTGTGG - Intergenic
1187453939 X:19424504-19424526 GAACAGTGGTTCTCAAAGTGTGG + Intronic
1187510536 X:19913666-19913688 ATACAGTGGTTCTCAAAGTGTGG - Exonic
1188736117 X:33718398-33718420 GAACAGTGTTTCTCAAAGTGTGG + Intergenic
1189142081 X:38617688-38617710 AACCAGTGTTGCTCAAAGTGTGG - Intronic
1189186352 X:39058807-39058829 TAGCAGTGTTTCTCAAAGTGTGG + Intergenic
1189871107 X:45383768-45383790 ATACAGTGGTTCTCAAAGGGTGG + Intergenic
1189907654 X:45778106-45778128 AAACACTCCCTCCCAAAGCGAGG + Intergenic
1189921731 X:45909145-45909167 GAGCAGTGTCTCTCAAACTGGGG + Intergenic
1190334561 X:49254446-49254468 AATCAGTGTTTTTCAAAGCAAGG + Intronic
1190450971 X:50580367-50580389 AAGCAGTGGTTCTCAAAGTGTGG - Intergenic
1191194296 X:57705052-57705074 AAGCAGTGTTTCTCAAAATGGGG - Intergenic
1191693637 X:63965769-63965791 AAACAATGTTTCTCAAAGTTTGG + Intergenic
1193127634 X:77886301-77886323 AACCTGTGTTTCTCAAAGTGTGG + Intronic
1193955100 X:87850447-87850469 AGACAGTGTTTTTCAAAGTGTGG + Intergenic
1195404870 X:104501810-104501832 CAACAGTGGCTCTCAAAGTGTGG + Intergenic
1196910465 X:120479593-120479615 GAACAGAGTTTCTCAAAGTGTGG - Intergenic
1197592353 X:128423816-128423838 TGACAGTGTTTCTCAAAGTGTGG - Intergenic
1197963429 X:132030798-132030820 AAACAATGTCTCTGAAGGAGTGG + Intergenic
1199683599 X:150244474-150244496 AAATAGTATTTCTCAAAGTGTGG + Intergenic
1199736160 X:150688577-150688599 TAACAGGGTTTCTCAAAGTGTGG + Intergenic
1201298387 Y:12485381-12485403 AAACAGTGTATTTGAAAGCATGG + Intergenic
1201417903 Y:13766261-13766283 AAACAGTGGCTTTCAAAGTGTGG - Intergenic
1201741986 Y:17333940-17333962 AAACAGTGACTCACTAACCGGGG - Intergenic