ID: 954914671

View in Genome Browser
Species Human (GRCh38)
Location 3:54138718-54138740
Sequence CCCCAAATGCAGAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954914671_954914676 10 Left 954914671 3:54138718-54138740 CCATCCTCATTCTGCATTTGGGG 0: 1
1: 0
2: 1
3: 27
4: 219
Right 954914676 3:54138751-54138773 CAAGATCACGAAGCTAGTGATGG 0: 1
1: 0
2: 1
3: 52
4: 350
954914671_954914677 20 Left 954914671 3:54138718-54138740 CCATCCTCATTCTGCATTTGGGG 0: 1
1: 0
2: 1
3: 27
4: 219
Right 954914677 3:54138761-54138783 AAGCTAGTGATGGAAGAGCCAGG 0: 1
1: 0
2: 1
3: 25
4: 215
954914671_954914678 26 Left 954914671 3:54138718-54138740 CCATCCTCATTCTGCATTTGGGG 0: 1
1: 0
2: 1
3: 27
4: 219
Right 954914678 3:54138767-54138789 GTGATGGAAGAGCCAGGTGAAGG 0: 1
1: 0
2: 1
3: 37
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954914671 Original CRISPR CCCCAAATGCAGAATGAGGA TGG (reversed) Intronic
902043745 1:13510642-13510664 GCACAAATGCAGGAGGAGGAGGG + Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902890811 1:19442073-19442095 CTCCAAATGCTGAAAGATGAAGG + Intronic
902976232 1:20090534-20090556 CACCAAGAGCAGAATGAGGGTGG - Intronic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904496985 1:30892602-30892624 CCCCAAACCCAGGACGAGGATGG + Intronic
905632189 1:39525017-39525039 CCCCAAGTGCAGAAGTGGGAAGG + Intronic
907585925 1:55617861-55617883 TCCCAAATGTAGAATGAAGGTGG + Intergenic
908857875 1:68449936-68449958 CACCAACTGCAGAATGAAGAAGG + Exonic
909635876 1:77816847-77816869 CCTCAAATGTAGAATAAGAATGG + Intronic
910079539 1:83325234-83325256 CCCAAATTACAGAATGAGGAGGG + Intergenic
910508708 1:87979464-87979486 CCCCAATTACAGAATGTGGATGG - Intergenic
911906253 1:103571655-103571677 CCCCAAATACACAACAAGGACGG + Exonic
911909722 1:103617493-103617515 CCCCAAATACACAACAAGGACGG + Exonic
912467463 1:109883823-109883845 CCCCAGAGGCTGAAGGAGGAAGG + Intergenic
912649014 1:111421782-111421804 CCCCACAGGCAGAAGGAGCAGGG - Intronic
912803897 1:112740986-112741008 AACCAAATCCAGTATGAGGAAGG + Intergenic
913224506 1:116687168-116687190 CTCCACAGGCAGAATGGGGAGGG - Intergenic
916246893 1:162697025-162697047 CCCCCTACGCAGAATGAGAATGG - Intronic
918760950 1:188406389-188406411 GCCCAAAGGCATAATGTGGAAGG - Intergenic
920985192 1:210882309-210882331 CCTCAAATGGAGATTGAGCAAGG + Intronic
923470161 1:234283126-234283148 CCCCAAATGGAGATGGAGGTGGG - Intronic
1062945543 10:1458576-1458598 CCCCAAGTGGAGAAGGAAGAAGG - Intronic
1063090707 10:2863950-2863972 TCACAAATTGAGAATGAGGAGGG + Intergenic
1063331601 10:5165171-5165193 ACCCAAATGGAGAGGGAGGAGGG - Intergenic
1063451058 10:6150654-6150676 CCCTAAATGCTGAAAGATGATGG + Intronic
1071305863 10:84298401-84298423 GCCCAAACCCACAATGAGGAAGG - Intergenic
1071869730 10:89780921-89780943 CCCCAATTCCAGAATTTGGATGG - Intergenic
1072762289 10:98066678-98066700 CCCCCAAAGCAGAATGAGGGTGG - Intergenic
1073983140 10:109177664-109177686 GGCCAAATTCAGAGTGAGGAAGG - Intergenic
1076452252 10:130564921-130564943 CCCCAAATGCAGAGGCAGGGAGG - Intergenic
1076800755 10:132826974-132826996 GCCCAAATGGAGAATCAGGCAGG - Intronic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1078353648 11:10616742-10616764 CCACTAATACAGAAGGAGGAAGG - Intronic
1078353714 11:10617330-10617352 CCACAAATACAGAAGGAGCAAGG + Intronic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1082833927 11:57638780-57638802 CCACGAGTGGAGAATGAGGAGGG - Intergenic
1083332459 11:61905326-61905348 GGCCACATGCAGAATGAGGGAGG + Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1086407818 11:86514010-86514032 CCCCACATGCAGAGAGAGGGAGG + Intronic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1088661804 11:112054619-112054641 CTCCAAATGAAGAATGACCAAGG - Intronic
1089315853 11:117590789-117590811 CCTCAAATGCAGACTGAGAATGG + Intronic
1089923172 11:122229832-122229854 CCCAACATGCGGACTGAGGAGGG - Intergenic
1090716203 11:129433601-129433623 CCCTAAAGGCCGAATGAGCATGG - Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092364962 12:7870252-7870274 CCCCATCTGCAAAATGAGCAAGG + Intronic
1096194340 12:49640058-49640080 ACCCAAATGGGGAAAGAGGAAGG - Exonic
1098051561 12:66459302-66459324 CACCCAAAGTAGAATGAGGATGG - Intronic
1098180586 12:67841936-67841958 CCCAAATTCCAGATTGAGGAAGG + Intergenic
1100029665 12:90170705-90170727 TAGCAAATGCAGAATGAGAAAGG + Intergenic
1101397586 12:104362221-104362243 CCCCCCATGCAGCATGGGGAGGG + Intergenic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1104766563 12:131333754-131333776 CCACAGGTGCAGAGTGAGGAGGG + Intergenic
1105061352 12:133153977-133153999 CCCCTAATCCAGTATGAGGGTGG - Intronic
1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG + Intergenic
1108533666 13:51349682-51349704 TCCTAAAAGCAGAATCAGGACGG - Intronic
1110557457 13:76876625-76876647 CCCAAAAAGCAGAATGGAGAAGG + Intergenic
1110847984 13:80211491-80211513 ACCCAAAGGAAGAGTGAGGAAGG + Intergenic
1117662884 14:58026715-58026737 CCTAAAATTGAGAATGAGGAGGG - Intronic
1118319982 14:64747391-64747413 CCCCAGATACAGAAAGAGGCTGG + Exonic
1118772719 14:68952839-68952861 CCCCAAATGGAAAGTGTGGATGG + Intronic
1120409876 14:84141006-84141028 TTCCAAATGCAGAATGAGACAGG - Intergenic
1121664891 14:95665004-95665026 CTCCAAATGCACCAAGAGGATGG + Intergenic
1121969318 14:98342038-98342060 CCTCAAATGAAAAATGGGGATGG - Intergenic
1122135016 14:99627811-99627833 ACACAAATGCAGGATGAGAAAGG + Intergenic
1122288466 14:100666815-100666837 CTCCAAAGCCAGAATGATGAGGG - Intergenic
1123191887 14:106579341-106579363 CCTCAAATGCAGAAAAAGGCTGG + Intergenic
1202828271 14_GL000009v2_random:279-301 CCCCTACTCCAGAATTAGGAGGG - Intergenic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1130126934 15:81101857-81101879 CCCCAAACTCAGAATCAGGATGG + Intronic
1130666349 15:85872917-85872939 CACCAAATGCATAAACAGGATGG - Intergenic
1131045290 15:89310029-89310051 CCCCATATGCATGATGAGAAAGG + Intronic
1131204229 15:90427892-90427914 GCCCAAACTCAGAATGAGTAAGG + Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133618736 16:7505616-7505638 CTCCAAATGGAAAATCAGGATGG + Intronic
1134044776 16:11093124-11093146 CCCCAAAAGCACCATGAGAAGGG - Intronic
1135040418 16:19113840-19113862 CCCCGAAGGCAGAATTGGGAAGG - Intergenic
1137665779 16:50248153-50248175 CCCTAAATGCAGAATCAAGTGGG + Intronic
1137768795 16:50998020-50998042 CCCCAACTGCAAAATGGGGGCGG - Intergenic
1140119389 16:72070489-72070511 TCCGAACAGCAGAATGAGGATGG + Intronic
1140936483 16:79675501-79675523 CCCCAAATCTATAAAGAGGATGG + Intergenic
1141028905 16:80571021-80571043 CCCAAAATGGGGAAGGAGGAAGG + Intergenic
1143478224 17:7215000-7215022 CCCCAAATGCTGGATGGGGTAGG - Intronic
1143660390 17:8320987-8321009 ACCCTAATGCAGGCTGAGGAGGG + Exonic
1146579781 17:34026695-34026717 CCCCAAATGCCAAAGGTGGATGG + Intronic
1147140645 17:38458822-38458844 CCCCAAATTCACAATGAGTGAGG - Intronic
1149254029 17:54804356-54804378 CTCCAAATGCAGCCTCAGGAAGG + Intergenic
1149585474 17:57783326-57783348 ACTCTGATGCAGAATGAGGAAGG + Intergenic
1149787855 17:59451596-59451618 CGCCCAGTGCAGAATGATGAGGG - Intergenic
1153459050 18:5313548-5313570 TCCCAAATGCACACAGAGGATGG - Intergenic
1153460050 18:5323088-5323110 CCCCAGTTACAGAATCAGGAAGG - Intergenic
1157491526 18:48127121-48127143 CCCCATTTGCAAAATGGGGATGG - Intronic
1157528255 18:48401571-48401593 CCCCATCTGCAGTATGGGGATGG + Intronic
1157694536 18:49710398-49710420 TTCCAAATGCAGAGAGAGGAGGG - Intergenic
1158482660 18:57835693-57835715 CCCCAAGTTCAGCAGGAGGATGG - Intergenic
1166816672 19:45550512-45550534 CCCCAGCTGCAGAGTGAGGAGGG - Intronic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1202644428 1_KI270706v1_random:127541-127563 CCCCTACTCCAGAATTAGGAGGG + Intergenic
926087058 2:10027215-10027237 CCCCAAAGGCAGCATCAGGTAGG - Intergenic
926307764 2:11651498-11651520 CCCTAAATGAAGAAATAGGAGGG - Intergenic
926903536 2:17784558-17784580 TCCCAGTTCCAGAATGAGGAAGG + Exonic
928741602 2:34360832-34360854 CCCCAAATACGGAATCAGAAGGG + Intergenic
928752543 2:34487615-34487637 TCCCCACTGCAGAAAGAGGAAGG + Intergenic
929379350 2:41332199-41332221 CCACAGATGCAGTATGATGAGGG + Intergenic
931255512 2:60568832-60568854 CTAGAAATGCATAATGAGGATGG - Intergenic
931689192 2:64821013-64821035 CCCCAAATAAAGCATGAGCAGGG - Intergenic
931940281 2:67244547-67244569 CCCCCAACGCAGAATAGGGATGG - Intergenic
934717663 2:96552863-96552885 CCCCATCTCCACAATGAGGAAGG - Intergenic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935605089 2:104963981-104964003 CCACAAATGCAGAGGGATGATGG - Intergenic
936284722 2:111173254-111173276 CCCTAATGGCAGAGTGAGGATGG - Intergenic
940329474 2:152458522-152458544 CTCCAAATGTGGAGTGAGGATGG - Intronic
941864783 2:170323539-170323561 TCCCAAATGCAGAAACAAGATGG + Intronic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
947951358 2:234150318-234150340 CCCCAAATGGAGGATCAGGACGG - Intergenic
948685352 2:239666432-239666454 CCCCATTTGTAGAATGACGATGG + Intergenic
1168851440 20:979750-979772 CCCCAAATGCAGAAGGAGCTGGG - Intronic
1170209367 20:13833177-13833199 CTGCAAATGCAGAATGAAAATGG - Intergenic
1171023304 20:21606893-21606915 CCCAAATGCCAGAATGAGGAGGG + Intergenic
1171079038 20:22159109-22159131 TCCCAAAAGCAGACAGAGGATGG + Intergenic
1172025009 20:31942645-31942667 CTCCAGATGCTGAATGTGGATGG - Intronic
1172330885 20:34075391-34075413 CCCCATATGCCAAATGAGGATGG - Intronic
1172578490 20:36028281-36028303 CCGCAAATGCTGACTGAGCAGGG - Intronic
1173997350 20:47348605-47348627 CCACAAAAGTGGAATGAGGAAGG + Intronic
1176607453 21:8845113-8845135 CCCCTACTCCAGAATTAGGAGGG - Intergenic
1176905618 21:14497030-14497052 GCCCAGATGGAGAGTGAGGAGGG - Intronic
1177041111 21:16112641-16112663 CCCCAAAGGCAGAATAATGATGG - Intergenic
1178921430 21:36741331-36741353 CCCCAAATCCTTAATGGGGAGGG - Intronic
1180078228 21:45473874-45473896 CCCTAAATGCAGACAGAGAAAGG - Exonic
1180380728 22:12137433-12137455 CCCCTACTCCAGAATTAGGAGGG + Intergenic
1181532871 22:23526986-23527008 CCACAAATGCAGAGTGAGTCTGG + Intergenic
1181862304 22:25828597-25828619 CCCCAACTGTTAAATGAGGATGG - Intronic
1181967633 22:26668071-26668093 CCTCAGATGCAGAATTAGGCTGG + Intergenic
1185196125 22:49470591-49470613 CCCCAACTGCGGAAGGAGGACGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
951589442 3:24247434-24247456 CCCCAACTGTAAAATGTGGATGG - Intronic
951830724 3:26923777-26923799 CCCCAAATGTAGAATGACATGGG - Intergenic
952684163 3:36130513-36130535 CCTCAAATTCAAAATGAGAAAGG + Intergenic
953503481 3:43460479-43460501 CCCCAATGCCAGAATGTGGAAGG - Intronic
953591709 3:44262923-44262945 CCTCACATGCAAAATGAGGGTGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954911998 3:54118586-54118608 CCCCAAATGCAGACTGATACAGG + Intergenic
954914671 3:54138718-54138740 CCCCAAATGCAGAATGAGGATGG - Intronic
955131690 3:56175692-56175714 CCCTGAATGCAGAATTGGGAAGG + Intronic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
958128642 3:89389533-89389555 TCCCAAATCTAGAAAGAGGAAGG + Intronic
959410739 3:106018024-106018046 CCCAATATGCAGAATGAGATTGG + Intergenic
959949875 3:112167775-112167797 ACCCAAATCCACAATGAGTAGGG + Intronic
960109194 3:113828716-113828738 CACCAAGTGCAGAAAGAGTAGGG - Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
961826614 3:129602457-129602479 CCGCAAAGGGAGAATGAGGGTGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963266665 3:143246446-143246468 CCCAAATTCCTGAATGAGGAGGG + Intergenic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
969472737 4:7399248-7399270 CCTCAAATGCAGACAGAGGGTGG - Intronic
972123219 4:35731837-35731859 CCCTAATCCCAGAATGAGGAAGG + Intergenic
973370666 4:49246076-49246098 CCCCTACTCCAGAATTAGGAGGG + Intergenic
973390362 4:49549358-49549380 CCCCTACTCCAGAATTAGGAGGG - Intergenic
975119366 4:70711836-70711858 TCACAAAGGCAGAATCAGGAAGG - Intronic
976382041 4:84410611-84410633 CCCCAATTGCACAATGGGAAAGG - Intergenic
976985725 4:91294531-91294553 CCTGAAATGCAAAATCAGGATGG + Intronic
978128609 4:105165708-105165730 CCCTAAATGCAGACTTAGAAAGG - Intronic
978453161 4:108859206-108859228 TCCCATCTACAGAATGAGGATGG - Intronic
983650392 4:170031254-170031276 GTCCAAACCCAGAATGAGGAAGG - Intronic
984078284 4:175211078-175211100 CCCCAAAAGAAGAAAAAGGAGGG + Intergenic
985000909 4:185481587-185481609 GGCCATCTGCAGAATGAGGAGGG - Intergenic
986664308 5:10086988-10087010 ACCCAAGTTCTGAATGAGGAGGG + Intergenic
986964593 5:13255091-13255113 CTCCAAATGCATAATGACGATGG - Intergenic
987284436 5:16441570-16441592 CCCCAACTGCAGAAGGGGTAGGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989717310 5:44479426-44479448 CCACATATGCACTATGAGGATGG + Intergenic
990684185 5:58281738-58281760 ACCCAAATGCAGCAGGAAGAGGG + Intergenic
991043137 5:62195863-62195885 CCCCAAACGCAGAATGAAGGAGG + Intergenic
991301154 5:65130456-65130478 CTCCAAATACAGCATGAGGCTGG + Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
996017538 5:118557269-118557291 CCCCAGGTGCTGAATGGGGATGG - Intergenic
996685979 5:126281224-126281246 ACCCAACTGCAGAATGACAAAGG + Intergenic
997800504 5:136856199-136856221 CACCACATGAAGAATGGGGAGGG + Intergenic
999563447 5:152830571-152830593 CCTCAACTGCAGAATGGTGATGG - Intergenic
999645037 5:153709336-153709358 CCCCAAATACTAAATTAGGAAGG - Intronic
1000203856 5:159038315-159038337 ACCTAAATGCAGAATGGAGAAGG - Intronic
1002191417 5:177479701-177479723 GGCCAAATCCAGCATGAGGACGG - Intergenic
1002955117 6:1854648-1854670 GCCCACATGCTGAATGAGAATGG - Intronic
1004517403 6:16332123-16332145 CCCTAAATGTAGGAGGAGGATGG - Intronic
1005864227 6:29926480-29926502 CCCCAAGAGCAGCAGGAGGAGGG - Intergenic
1005905532 6:30259647-30259669 CCCCAAGAGCAGCAGGAGGAGGG - Intergenic
1006722949 6:36171616-36171638 CTCAAATTCCAGAATGAGGAGGG + Intergenic
1007362437 6:41368628-41368650 GCTCAAATGGAGAATGAGAAAGG + Intergenic
1008383789 6:50863603-50863625 CTCCAAAGGGGGAATGAGGAAGG + Intergenic
1008684924 6:53914790-53914812 CCCCAAATGCAGATTCAGAAAGG - Intronic
1011831416 6:91376481-91376503 CCACAAATGCAAAATGACAAGGG + Intergenic
1015137515 6:129890562-129890584 CTCCAAATGCAGAGTGAGCAGGG + Intergenic
1017029406 6:150207510-150207532 CCCCAAATCCAGATTGAGGAAGG - Intronic
1017102113 6:150857991-150858013 CCCCAAATGCAGAAGGAGCCTGG - Intergenic
1018144865 6:160876788-160876810 CCCCAAATGGTGTCTGAGGAAGG + Intergenic
1018431266 6:163724573-163724595 CTCCAAATGGAGAGTGAGGATGG + Intergenic
1019301722 7:307856-307878 ACCACAATGCAAAATGAGGAGGG + Intergenic
1020666157 7:11046722-11046744 CCCATAATGCAGAAGTAGGAGGG + Intronic
1020786569 7:12580711-12580733 CCCCAAATCAATAATGAGCAAGG - Intronic
1021958679 7:25852144-25852166 CCCCAAAAGCAGCATGACCAGGG - Intergenic
1023225787 7:37967427-37967449 GACTAAATGCAGAATGAGAATGG - Intronic
1023574589 7:41612874-41612896 CTCTAAATTCAGAGTGAGGAAGG - Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024635035 7:51280293-51280315 CCCCTAATGTTTAATGAGGAGGG + Intronic
1027297300 7:76790522-76790544 CCCAAATTACAGAATGAGGAGGG + Intergenic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1028309744 7:89316520-89316542 CCACAAACGCAGAAAAAGGAAGG + Intronic
1028735362 7:94205402-94205424 TCCCAAAGGCAGAAGGAGAATGG + Intergenic
1029725292 7:102399306-102399328 ACTCAAATGCAGTATCAGGAGGG - Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030558229 7:111053262-111053284 CCCCAAGGGAAGAATCAGGAGGG - Intronic
1031805852 7:126305109-126305131 CTCCAAAGGGAGAATGAGGTAGG + Intergenic
1033755270 7:144393806-144393828 CTCCAAGTGCAAAATGAGGAGGG + Intergenic
1035956662 8:4088087-4088109 CCACAAAAGGAGAAAGAGGAAGG + Intronic
1039436608 8:37563856-37563878 CCACAAAAGCAGAAGGAAGAAGG + Intergenic
1040814089 8:51488597-51488619 CCTAAATTCCAGAATGAGGAAGG - Intronic
1047895155 8:129358410-129358432 CCCCATAAACAGAATGAGAATGG - Intergenic
1048344088 8:133563514-133563536 CCCCAAATCCAAACTGAGGCGGG + Intronic
1049306502 8:141906956-141906978 CCCCACATGCAGCAGGAGGAAGG - Intergenic
1050538467 9:6649984-6650006 AGCCAAAAGCAGATTGAGGAGGG + Intergenic
1050887587 9:10784988-10785010 CCCCAAATGCATAATTGGAATGG - Intergenic
1054814015 9:69457187-69457209 ACCCAGATGCAGAAGGAGTAAGG + Intronic
1057943268 9:99303359-99303381 CCAAAACTACAGAATGAGGAAGG - Intergenic
1058217085 9:102248178-102248200 CACAAAATGGAGAATGAGGAAGG - Intergenic
1058632952 9:107008136-107008158 CCCCAACTGCATAATGAGAGGGG - Intronic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1061342669 9:129995671-129995693 CCCCAAATAAAGAATGAGAGGGG + Intronic
1203695076 Un_GL000214v1:90903-90925 CCCCTACTCCAGAATTAGGAGGG + Intergenic
1203702788 Un_KI270742v1:10001-10023 CCCCTACTCCAGAATTAGGAGGG - Intergenic
1203641197 Un_KI270751v1:13160-13182 CCCCTACTCCAGAATTAGGAGGG - Intergenic
1186554593 X:10544408-10544430 CACTAAATGCACAATGTGGAAGG + Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1188354405 X:29173667-29173689 CCGCAAATTCAGAATTAGCATGG + Intronic
1188643460 X:32535341-32535363 CTCCAAATGAACAATTAGGAGGG - Intronic
1190283770 X:48948675-48948697 CCCCAAAAGGAGAAAGAGAAGGG - Intronic
1191749740 X:64528909-64528931 CCTCAAATGCATAGTGAGGTAGG - Intergenic
1193602437 X:83524271-83524293 CCCCATCTGCAAAATGAGCAAGG - Intergenic
1196051788 X:111313273-111313295 TCACACATGCAGAATGAGGTAGG - Intronic
1196570312 X:117259230-117259252 ACCCAAATACAGAAGGAGAATGG + Intergenic
1197414940 X:126164453-126164475 GCACAAATGCAGCATGAAGAAGG + Intergenic
1199684597 X:150255017-150255039 CTCCAGCTGAAGAATGAGGATGG + Intergenic
1199843330 X:151672823-151672845 CCACACATGCAGAAGGATGATGG - Intronic
1200409240 Y:2845179-2845201 CCCCAAATCCTGAGTGAGGCAGG + Intronic
1200624069 Y:5490682-5490704 CCTCCAATTCAGAAGGAGGAGGG - Intronic
1201613260 Y:15866640-15866662 CTCAAAATGCAGTATGTGGATGG + Intergenic