ID: 954922579

View in Genome Browser
Species Human (GRCh38)
Location 3:54204373-54204395
Sequence TTATATTAGCCAAGGTTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 1, 2: 6, 3: 44, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954922579_954922583 8 Left 954922579 3:54204373-54204395 CCGGAGAACCTTGGCTAATATAA 0: 1
1: 1
2: 6
3: 44
4: 185
Right 954922583 3:54204404-54204426 TCCTATGTGCACAAACATCAAGG 0: 1
1: 1
2: 0
3: 12
4: 121
954922579_954922585 25 Left 954922579 3:54204373-54204395 CCGGAGAACCTTGGCTAATATAA 0: 1
1: 1
2: 6
3: 44
4: 185
Right 954922585 3:54204421-54204443 TCAAGGATAACCAGACCTTGAGG 0: 1
1: 0
2: 0
3: 10
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954922579 Original CRISPR TTATATTAGCCAAGGTTCTC CGG (reversed) Intronic
900719778 1:4167979-4168001 CTGTATTAGTCAGGGTTCTCTGG + Intergenic
901152673 1:7114259-7114281 CTGTATTAGTCAGGGTTCTCTGG + Intronic
902355043 1:15891775-15891797 TTATATTAGCCCAGGTACAGCGG - Intronic
905979413 1:42210385-42210407 TTATGTTACCCAAGGTACTCTGG - Intronic
906773544 1:48507374-48507396 ATGTATTAGTCAGGGTTCTCTGG - Intergenic
912749643 1:112275723-112275745 TTGTATTAGTCAGTGTTCTCTGG - Intergenic
915899874 1:159839168-159839190 TTATATCAGTCAGGGTTCTTTGG + Intronic
916124059 1:161553597-161553619 TTATCTTAACCTAGGATCTCTGG - Intergenic
916133942 1:161634959-161634981 TTATCTTAACCTAGGATCTCTGG - Intronic
916357351 1:163927362-163927384 CTGTATTAGTCAGGGTTCTCCGG + Intergenic
916922119 1:169479867-169479889 TAATATGAGCTAAGGTTCTAAGG + Intronic
919557325 1:199074842-199074864 ATGTATTAGTCAGGGTTCTCTGG - Intergenic
921772241 1:219054520-219054542 CTATATTAGTCAGGGTTCTCAGG - Intergenic
922165199 1:223109538-223109560 TTAAATTGGCCAAGGATGTCAGG - Exonic
924004510 1:239593089-239593111 TTTTATCAGCAAAGCTTCTCTGG - Intronic
924041275 1:239986032-239986054 CTATATTAGCCAAAGCACTCTGG - Intergenic
924331436 1:242944527-242944549 TTGTATTAGTCAAGGTTTTCAGG + Intergenic
924579311 1:245309978-245310000 TTGTATTGGCCAGAGTTCTCTGG - Intronic
924579318 1:245310209-245310231 TTGTATTTGCCAGGGTTCTCTGG - Intronic
924708579 1:246517160-246517182 TCATATTTCCCAGGGTTCTCAGG + Intergenic
1063262926 10:4410523-4410545 CTGTATTAGTCAGGGTTCTCTGG - Intergenic
1064234269 10:13559568-13559590 TTGTATTAGTCAGGTTTCTCTGG - Intergenic
1064518076 10:16171514-16171536 CTGTATTAGTCAGGGTTCTCTGG + Intergenic
1065404235 10:25345649-25345671 TTTTATTAGCTATAGTTCTCTGG + Intronic
1065736225 10:28755054-28755076 GTATCTTAGCCTGGGTTCTCTGG + Intergenic
1068873773 10:61974904-61974926 TTAAATTAGCCTGGGGTCTCGGG + Intronic
1070191145 10:74112940-74112962 GTATGTTAGACAAGGTCCTCTGG - Intronic
1071072042 10:81705558-81705580 GTGTATTAGTCAGGGTTCTCTGG - Intergenic
1074475737 10:113772458-113772480 TAATATGAGCCAAGGTCCTTGGG + Intronic
1074548509 10:114421191-114421213 TTCTATCAGCAAAGCTTCTCTGG - Intergenic
1079717218 11:23763686-23763708 TTATATTAGTCAAGGTTCTCCGG + Intergenic
1080407497 11:31992680-31992702 TTATTTTCTCCAAGGTTTTCTGG - Intronic
1080417347 11:32081174-32081196 ATGTATTAGTCACGGTTCTCTGG - Intronic
1082129832 11:48474669-48474691 GTATATCAGCCATGGTTCTTAGG + Intergenic
1082247271 11:49939040-49939062 TTATATCAGCCATGGTTCTTAGG - Intergenic
1082563355 11:54645575-54645597 GTATATCAGCCATGGTTCTTAGG + Intergenic
1086629740 11:89002894-89002916 GAATATTAGATAAGGTTCTCTGG - Intronic
1089676249 11:120091981-120092003 CTGTATTAGTCAAGGCTCTCTGG - Intergenic
1090511569 11:127380995-127381017 CTATATTAGTCAGGGTTCTCTGG - Intergenic
1090555253 11:127867616-127867638 TTATTTTGGCCTAGGATCTCAGG - Intergenic
1091041694 11:132286864-132286886 GTAGAATAGCCAGGGTTCTCAGG - Intronic
1092802255 12:12180965-12180987 TTATCTTAGTCAATGTTTTCAGG + Intronic
1093936730 12:25009510-25009532 GTGTATTAGCCAGGGCTCTCTGG + Intergenic
1096451619 12:51747428-51747450 TAAAATTAGCCAAAGTTCTTAGG - Intronic
1097761331 12:63468384-63468406 TTATTTTAGGCAAGGTGATCAGG - Intergenic
1098235178 12:68411350-68411372 TAAAATTAGCCAAGGTTCTTTGG - Intergenic
1100751356 12:97701824-97701846 TTATATTCGCCATGGTTCTCAGG - Intergenic
1104152308 12:126095505-126095527 TTCTATTAGAAAAGGTTCACAGG - Intergenic
1105621896 13:22076037-22076059 TTCTATCAGCCAAAGTTATCTGG - Intergenic
1105655599 13:22434164-22434186 CTATATTAGCAAATGCTCTCGGG - Intergenic
1106213669 13:27674577-27674599 TTATAGTAGCGAAGGTCCTTTGG - Intergenic
1106351290 13:28933087-28933109 ATATATTAGTGTAGGTTCTCTGG + Intronic
1109155419 13:58903322-58903344 TTGTATTAGTCAGGGTTCTCCGG - Intergenic
1109204674 13:59468106-59468128 TTACATTAGTCAGGGTTCTCTGG - Intergenic
1111623811 13:90757469-90757491 CTGTATTAGTCACGGTTCTCCGG - Intergenic
1113169373 13:107482380-107482402 GTGTATTAGTCGAGGTTCTCTGG - Intronic
1113301107 13:109020149-109020171 TTATATGAGCAAAGGATCCCTGG + Intronic
1114688332 14:24556266-24556288 CTATATTAGTCAGGGTTCTCTGG + Intergenic
1115006664 14:28493973-28493995 CTATATTAGTCAGGATTCTCTGG + Intergenic
1115483383 14:33884756-33884778 TTTTATTAGCAAAGGTTCTTCGG - Intergenic
1116278027 14:42861962-42861984 CTGTATTAGCCAGGGTTCCCTGG + Intergenic
1116309186 14:43300290-43300312 TTATATCCGCCACGGTTCCCAGG - Intergenic
1116475716 14:45336373-45336395 TTATATTAGCAGAGCTACTCTGG + Intergenic
1117253962 14:53959670-53959692 GTATATTTCACAAGGTTCTCTGG + Intergenic
1118845440 14:69544559-69544581 TTAAAGGAGACAAGGTTCTCTGG - Intergenic
1120396681 14:83975917-83975939 GTATATTAGCTAAGTTTGTCAGG + Intergenic
1120507102 14:85366293-85366315 ATGTGTTAGCCAGGGTTCTCTGG + Intergenic
1123507714 15:20961444-20961466 GTATGTTAGCCCAGGTTCTGGGG + Intergenic
1123564935 15:21535184-21535206 GTATGTTAGCCCAGGTTCTGGGG + Intergenic
1123601195 15:21972478-21972500 GTATGTTAGCCCAGGTTCTGGGG + Intergenic
1124988520 15:34647224-34647246 TTATGATAGCCAGGGTTCTGTGG + Intergenic
1127810246 15:62559644-62559666 TTATTTTAGGCAAGGCTCTTTGG + Intronic
1131759703 15:95608500-95608522 TTATTTTAACCAAGGTTAGCTGG + Intergenic
1132125988 15:99225143-99225165 TGATAATAGCCTTGGTTCTCAGG + Intronic
1202973303 15_KI270727v1_random:262297-262319 GTATGTTAGCCCAGGTTCTGGGG + Intergenic
1133908725 16:10045340-10045362 TTATGTTTACCAAGGGTCTCTGG + Intronic
1136503797 16:30689437-30689459 TTATTTTAGACAAGATTGTCTGG - Intergenic
1137811120 16:51353476-51353498 ATATATTAGCTAAGGTTATAAGG + Intergenic
1138868724 16:60853618-60853640 GTGTATTAGTCAGGGTTCTCTGG - Intergenic
1139017647 16:62709538-62709560 CTATATTACCCCAGGTTTTCTGG - Intergenic
1139234644 16:65324687-65324709 CTATGTTAGCCAAGCTGCTCTGG + Intergenic
1140787951 16:78361942-78361964 TTATATTAGCGTAGATTCACAGG + Intronic
1141963918 16:87428494-87428516 TTTCATTAGTCAAGGTTCTATGG + Intronic
1144430320 17:15185290-15185312 TTTTATTAGCCAAGGTTTAATGG - Intergenic
1148287346 17:46406153-46406175 TTTTATTAGTCAAGATTCTTTGG + Intergenic
1148309516 17:46623733-46623755 TTTTATTAGTCAAGATTCTTTGG + Intronic
1149005444 17:51800562-51800584 TTAACTTAGCCAAGGTTGTAAGG - Intronic
1149321291 17:55484007-55484029 CTATATTAGTCAGGGTTCCCTGG - Intergenic
1150184360 17:63164487-63164509 ATGTATTAGTCAGGGTTCTCTGG + Intronic
1150951819 17:69811129-69811151 TTATATTAGTCAGAGTTATCTGG - Intergenic
1151049097 17:70956528-70956550 TTGTATTAATCAGGGTTCTCAGG + Intergenic
1151104833 17:71600722-71600744 TTATTTTAGCCAAGCTTTACTGG + Intergenic
1153715446 18:7842981-7843003 TTATATGAGCCAGGTTCCTCTGG + Intronic
1154211394 18:12382024-12382046 TTGTATTAGTCATGGTTTTCTGG - Intergenic
1155551280 18:26968196-26968218 CTGTATTAGTCAGGGTTCTCTGG - Intronic
1155671053 18:28371567-28371589 TAATATTATACAAGATTCTCAGG - Intergenic
1156001806 18:32393637-32393659 TTATGTTTGCCAATTTTCTCTGG + Intronic
1159667646 18:71182335-71182357 ATGTATTAGTCAGGGTTCTCTGG + Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1162688146 19:12405255-12405277 GTGTATTAGTCAGGGTTCTCTGG - Intronic
1163882561 19:19939408-19939430 TTATGATAGTCAAGGGTCTCTGG - Intergenic
929586462 2:43118339-43118361 CTATATTAGTCAGGGTTCTCTGG + Intergenic
932511011 2:72290312-72290334 GTGTATTAGTCATGGTTCTCTGG - Intronic
933463785 2:82624039-82624061 TCATATTGGCCAGGCTTCTCTGG - Intergenic
935368593 2:102320944-102320966 TAATAAAAGCCAAGGTGCTCAGG + Intronic
935830268 2:106994830-106994852 ATATATTAGTCAGGGTTCTGCGG - Intergenic
935832500 2:107014981-107015003 TTGTATTAGTCAGGGATCTCCGG - Intergenic
935865901 2:107387566-107387588 TAGTATTAGCTAAGGTTATCAGG + Intergenic
936627568 2:114164625-114164647 CTATATTAGTCAGGGTTCTATGG - Intergenic
938510666 2:131939150-131939172 TTATATTTGCCAAGTTTTTGTGG + Intergenic
939934824 2:148278630-148278652 TTGTTTTAGTCAGGGTTCTCCGG + Intronic
940070229 2:149678631-149678653 TTGTATTAGTCAGGGTTGTCCGG + Intergenic
940171742 2:150836013-150836035 CTGTATTAGTCAGGGTTCTCTGG + Intergenic
941219491 2:162758252-162758274 TTATATCTGCCCAGGATCTCAGG - Intronic
942694093 2:178619332-178619354 TTAGATTTGCCAAGACTCTCAGG + Intronic
943665216 2:190602072-190602094 ATGTATTAGTCAGGGTTCTCTGG + Intergenic
945732225 2:213553158-213553180 TTGTATTAGTCAAGGTTCTCTGG - Intronic
946048275 2:216839249-216839271 TTATATTAGCCAGTGTTTTAAGG + Intergenic
946531837 2:220578793-220578815 GTATACTAGCCAATATTCTCAGG - Intergenic
946888843 2:224252816-224252838 TTAGATTAGCCAAGATTTGCTGG - Intergenic
1169649190 20:7847893-7847915 TTGTGTTAGTTAAGGTTCTCTGG - Intergenic
1169916992 20:10693015-10693037 TTCTATTTACCAGGGTTCTCAGG + Intergenic
1170691648 20:18621736-18621758 ATATATTAGCCAAGATGTTCTGG - Intronic
1173317788 20:41960594-41960616 TTATATTTGGCAAGGGTCACTGG + Intergenic
1173710463 20:45151189-45151211 TCATATGAGCCAACCTTCTCAGG - Intergenic
1176783162 21:13224149-13224171 TTATATTTGCCAAGTTTTTGTGG - Intergenic
1177597006 21:23257619-23257641 TTGTATTAGCCAGGGTTCTCTGG + Intergenic
1178942200 21:36915417-36915439 TTATCTTAGCAAAGGTTCACTGG + Intronic
1179076053 21:38122873-38122895 GTATATTAATCAGGGTTCTCTGG + Intronic
1181562305 22:23712766-23712788 TTATATAATCCCAGGTACTCGGG - Intergenic
1181839564 22:25645032-25645054 AGATACTAGCCAAGGTTTTCTGG + Intronic
1184908279 22:47507168-47507190 TTGTATGAGTCAGGGTTCTCTGG - Intergenic
950200546 3:11039898-11039920 TTATTTTAGCCAAGGTGGTCAGG - Intergenic
950297558 3:11845261-11845283 TTATATTAGCTAAGGCGCTAAGG + Intronic
950529331 3:13544119-13544141 TTCCATTAGCCAAGGCTCTTGGG + Intergenic
952562061 3:34606242-34606264 TTACATTAGTCAGGGTTCTATGG - Intergenic
954922579 3:54204373-54204395 TTATATTAGCCAAGGTTCTCCGG - Intronic
957651703 3:83014737-83014759 TTGTGTTAGTCAGGGTTCTCCGG - Intergenic
960310859 3:116114545-116114567 TTATTATACCCAAGGCTCTCTGG - Intronic
963660978 3:148128890-148128912 CTGTATTAGTCAGGGTTCTCGGG - Intergenic
963967930 3:151394336-151394358 TTAAATTAGGCAAGGCCCTCAGG - Intronic
964310439 3:155386350-155386372 TTAGACTAGCCAAGGTTCTTTGG - Intronic
966271031 3:178106024-178106046 TTGTAATAGTCAGGGTTCTCCGG - Intergenic
966891698 3:184411893-184411915 TTGCATTTGCCAAGGTTCTCCGG + Intronic
967301903 3:188022427-188022449 TTATTTTTGCCAAGGTGCTCAGG - Intergenic
967699383 3:192573682-192573704 TTATGTTAGTCAGGGGTCTCTGG - Intronic
968344741 3:197992202-197992224 CTGTATTAGTCAAGGTTCTCCGG - Intronic
968883250 4:3312370-3312392 AAACATTAGCCAAGGTTCACTGG + Intronic
969948105 4:10805539-10805561 TTGTATTAGTCAGGGTTCCCTGG - Intergenic
970009291 4:11441174-11441196 GTATATTAGTCAGGGTTCTCTGG - Intergenic
970543413 4:17102070-17102092 GTGTGTTAGCCAGGGTTCTCTGG - Intergenic
970930961 4:21511157-21511179 TTATTTTAACCATGCTTCTCAGG + Intronic
971029043 4:22617112-22617134 CTGTATTAGTCAGGGTTCTCTGG - Intergenic
971111812 4:23593388-23593410 TCGCATAAGCCAAGGTTCTCTGG - Intergenic
971583633 4:28376326-28376348 CTGTATTAGTCAGGGTTCTCTGG + Intronic
972658152 4:41086812-41086834 TTTTTTTAGCCAAGTTGCTCTGG - Intronic
974833857 4:67222758-67222780 GTGTATTAGTCAGGGTTCTCTGG + Intergenic
975290612 4:72673903-72673925 TTGTATTAGTCAGGGTTTTCTGG + Intergenic
979184226 4:117768692-117768714 TCATATTGGCCAACCTTCTCTGG - Intergenic
979980329 4:127247289-127247311 TTTTATTAGAAAAGGTTCTGGGG - Intergenic
980736429 4:136895588-136895610 TTGTATTTGCCAGGATTCTCCGG - Intergenic
982888115 4:160809664-160809686 TTGTATTAGTCAGGGTTCTCTGG - Intergenic
983049153 4:163023697-163023719 TTGTATTAGTCAAGGTTCTCTGG - Intergenic
983275186 4:165608349-165608371 TTATAAGAGGCAAGGTTCTGAGG + Intergenic
984803329 4:183733939-183733961 TTATCTTAGCCCAGGTTCTCTGG - Intergenic
988024826 5:25671510-25671532 GTATATTAGTCAGGGTTCTCCGG - Intergenic
989030179 5:37110777-37110799 ATACATTAGCCCAGGTTCTGGGG - Intronic
989129651 5:38094128-38094150 TTATATTAGGCATGGTACTGTGG - Intergenic
989761976 5:45026397-45026419 TCATATTAGCCAGGATTGTCTGG - Intergenic
991042628 5:62191651-62191673 GTATATTAGTCAGGGTTCTCCGG - Intergenic
991248925 5:64537573-64537595 TGATTTTAGCCAAGTTTCTGGGG - Intronic
995836499 5:116405154-116405176 TTAGATAAGAAAAGGTTCTCTGG + Intronic
997309025 5:132864455-132864477 TCCTATTAGCCTTGGTTCTCAGG - Exonic
1000699887 5:164435608-164435630 TTATAACAGCCATGTTTCTCTGG + Intergenic
1000853911 5:166375576-166375598 TTGTATTAGTCAGGGTTCTCTGG - Intergenic
1003758953 6:9153032-9153054 CTGTATTAGTCAGGGTTCTCTGG - Intergenic
1004789859 6:19013011-19013033 ATATATTATCCAAGGCACTCAGG + Intergenic
1005423297 6:25675127-25675149 TAATATTATCTAACGTTCTCTGG + Intronic
1008912770 6:56753745-56753767 TTAAGTTAACCAAAGTTCTCTGG + Intronic
1012056140 6:94413433-94413455 TTATTTAAGACAAGGTTCACGGG - Intergenic
1012881707 6:104798808-104798830 TGCTAGTAGCCAAGGTTCTGAGG + Intronic
1014866027 6:126531580-126531602 TTGTATTAGTCAGGGTTCTCAGG + Intergenic
1016181353 6:141151934-141151956 TTGTATTAGTCAGGGTTCTCTGG + Intergenic
1017577678 6:155823336-155823358 TTGTATTAGTCAGGGTTCTCTGG - Intergenic
1019013875 6:168865953-168865975 ATATATTAGTCAGGGTTCTCTGG + Intergenic
1020396286 7:7722235-7722257 CTATATTAGTCAGGGTTCACTGG - Intronic
1022225077 7:28354585-28354607 TTGTATTAGTCAGGGTTCTCTGG - Intronic
1023565295 7:41518295-41518317 TTGTATTAGTCAGTGTTCTCTGG + Intergenic
1026100350 7:67379078-67379100 TCATATTATCCCAGTTTCTCGGG - Intergenic
1026324734 7:69299330-69299352 GTGTATTAGGCAGGGTTCTCTGG - Intergenic
1026367469 7:69663229-69663251 ATATATCAGCCAAGGCACTCTGG - Intronic
1030532798 7:110730953-110730975 TCATATTAGTCAGGGTTCTCTGG - Intronic
1030696776 7:112593441-112593463 GTATATTAGTCCAGGTTCTCTGG - Intergenic
1031832931 7:126649572-126649594 CTGTATTAGTCAAGGTTCTCTGG - Intronic
1033070455 7:138197123-138197145 CTGTATTAGTCAGGGTTCTCTGG - Intergenic
1033839667 7:145358975-145358997 TTATATTGGTCAGGGTTTTCTGG + Intergenic
1036356007 8:8043688-8043710 TCATATTGGGCAATGTTCTCTGG + Intergenic
1038058766 8:23889080-23889102 GTGTATTAGTGAAGGTTCTCAGG - Intergenic
1038680988 8:29667746-29667768 CTATATAAACCAAAGTTCTCCGG - Intergenic
1043149913 8:76702937-76702959 TTACAGTAGCTGAGGTTCTCAGG + Intronic
1043188806 8:77190498-77190520 ATGTATTAGTCAAGGTTCTCTGG - Intergenic
1043948179 8:86277765-86277787 ATGTATTAGTCAAGGTTCTCTGG - Intronic
1044161115 8:88916140-88916162 CCATATTGGCCAAGGTTGTCTGG - Intergenic
1044853810 8:96454243-96454265 TTCTATTAGCCAGGGCTCTCTGG - Intergenic
1045374355 8:101556450-101556472 TTTTATTAGCCAAGTCCCTCTGG - Intronic
1047624896 8:126646658-126646680 CTGTATTAGCCAGGGTTCTCTGG + Intergenic
1048113417 8:131492480-131492502 TTGTATTAGTCAGGGTTCTCTGG - Intergenic
1048416340 8:134231532-134231554 TTATCTTAGTCCAGCTTCTCTGG - Intergenic
1050134780 9:2450589-2450611 GTGTATTAGTCAGGGTTCTCTGG - Intergenic
1050290028 9:4144311-4144333 TTGTATTTGCCAAGTTTCTGAGG - Intronic
1050636189 9:7615710-7615732 CTATATTAGTCAGGGTTCTCTGG + Intergenic
1050776925 9:9275532-9275554 TTCCATTAGCCAAGGTTGGCTGG + Intronic
1052427238 9:28321506-28321528 CTGTATTAGTTAAGGTTCTCTGG + Intronic
1052465389 9:28822828-28822850 ATGTATTAGTCAGGGTTCTCTGG - Intergenic
1055663429 9:78530315-78530337 GTATGTTAGTCAGGGTTCTCTGG + Intergenic
1059000900 9:110347968-110347990 GTATATTAGTCAAAGTTCTCTGG - Intergenic
1059660928 9:116399290-116399312 TTATATTTGCCAAGGATATTAGG + Exonic
1062179288 9:135182249-135182271 CTGTATTAGTCAGGGTTCTCCGG - Intergenic
1185852706 X:3504147-3504169 ATGTATTAGTCAGGGTTCTCTGG + Intergenic
1186217470 X:7315424-7315446 CTGTATTAGTCAGGGTTCTCTGG + Intronic
1188213605 X:27451880-27451902 TTGTGTTAGTCAAGGTTTTCTGG + Intergenic
1188771730 X:34161719-34161741 CTATATCAGACAGGGTTCTCTGG - Intergenic
1188848622 X:35104494-35104516 GTGTATTAGTCAGGGTTCTCTGG - Intergenic
1191587815 X:62848189-62848211 TTGTATTAACCAGGATTCTCTGG - Intergenic
1193520721 X:82526018-82526040 CTGTATTAGTCAGGGTTCTCTGG + Intergenic
1193832533 X:86306811-86306833 CTTTATTAGTCAAGGTTCTCTGG - Intronic
1194342902 X:92727803-92727825 TTGTATTAGTCAGGGTTCTCTGG - Intergenic
1195430514 X:104784056-104784078 TTATATTAGGCAAGGTTCCTAGG - Intronic
1197679813 X:129370279-129370301 TTGTATTAGTCAGGGTTCTCTGG - Intergenic
1198066833 X:133106561-133106583 GTGTATTAGTCAGGGTTCTCTGG - Intergenic
1198426249 X:136523153-136523175 TTAAATAAGCAAAGGTTTTCTGG - Intergenic
1198868729 X:141153694-141153716 GTTTATTAGTCAGGGTTCTCTGG + Intergenic
1199021678 X:142885790-142885812 TCATATTAGTCAAGGTTCTCCGG - Intergenic
1200651265 Y:5844468-5844490 TTGTATTAGTCAGGGTTCTCTGG - Intergenic
1201228778 Y:11843714-11843736 TTGTATTAGTTAAGGTTTTCAGG + Intergenic
1201271313 Y:12258048-12258070 TTTTATTGGCCAGGCTTCTCTGG + Intergenic
1201497028 Y:14598838-14598860 TTCTATTAGTCAGGGTTCTCTGG + Intronic