ID: 954923695

View in Genome Browser
Species Human (GRCh38)
Location 3:54213968-54213990
Sequence CTGGGTCAACCCTACTGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954923688_954923695 8 Left 954923688 3:54213937-54213959 CCCAGGAATCAGTTGAGTGGTTG 0: 1
1: 0
2: 1
3: 11
4: 114
Right 954923695 3:54213968-54213990 CTGGGTCAACCCTACTGTAGTGG 0: 1
1: 0
2: 0
3: 5
4: 58
954923689_954923695 7 Left 954923689 3:54213938-54213960 CCAGGAATCAGTTGAGTGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 83
Right 954923695 3:54213968-54213990 CTGGGTCAACCCTACTGTAGTGG 0: 1
1: 0
2: 0
3: 5
4: 58
954923686_954923695 23 Left 954923686 3:54213922-54213944 CCGGGAGGAGAGAGGCCCAGGAA 0: 1
1: 0
2: 5
3: 55
4: 474
Right 954923695 3:54213968-54213990 CTGGGTCAACCCTACTGTAGTGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954923695 Original CRISPR CTGGGTCAACCCTACTGTAG TGG Intronic
903184617 1:21622274-21622296 CTGGGTCACCCCGACTGCTGGGG - Intronic
907118443 1:51989735-51989757 TTGGGTCTACCCTGCTGCAGAGG - Intronic
907403031 1:54237209-54237231 CAGGGTCAGCACTACTGTAAAGG + Intronic
913699642 1:121362112-121362134 CTCTGTCAACCCCACTGCAGTGG + Intronic
914137902 1:144917924-144917946 CTCTGTCAACCCCACTGCAGTGG - Intronic
920487050 1:206380821-206380843 CTCTGTCAACCCCACTGCAGTGG + Intronic
924648547 1:245902500-245902522 CTGGGTCAACCCATCTCCAGTGG + Intronic
1065424622 10:25586745-25586767 CTGGGTTAACCCAAATGCAGTGG + Intronic
1077013016 11:387727-387749 CTGGATCAATCCTACAGTAGAGG - Intergenic
1081816884 11:45950409-45950431 CTTGGACACCCCTGCTGTAGAGG - Intronic
1084626591 11:70312529-70312551 CTGAATCAACACTCCTGTAGGGG - Intronic
1090147398 11:124340116-124340138 CTGAGTCAAACCTACATTAGAGG - Intergenic
1113374436 13:109751030-109751052 CTAGGTCAACCCTTCTGTCACGG + Intergenic
1116308454 14:43289292-43289314 CTGGGTCAACTCATCTCTAGTGG - Intergenic
1121491461 14:94364184-94364206 CTGGGTCACAGCTACTGCAGAGG - Intergenic
1126691496 15:51292420-51292442 CTGGGTCAATCCCATTGCAGTGG - Intronic
1127329078 15:57921428-57921450 TTGGGGCAGCCCTACTGTTGGGG - Intergenic
1134569963 16:15282606-15282628 CTGAGTCAACTCTACTGCAGGGG + Intergenic
1134935023 16:18238520-18238542 CTGAGTCAACTCTACTGCAGGGG + Intergenic
1140475529 16:75237801-75237823 CTGGGCCAACCCTTCTGAGGAGG - Intronic
1141139099 16:81485874-81485896 CTTGGACCACCATACTGTAGAGG + Intronic
1146578195 17:34013049-34013071 CTGGCTCAACCCCCCTGGAGAGG + Intronic
1148165021 17:45477502-45477524 CAGGGTCAGCCCTTCTGTAAAGG + Intronic
1155864096 18:30942453-30942475 CAGGGGCTACCCTACTGTTGTGG + Intergenic
1162008811 19:7798691-7798713 CTGGGTCAATCCTACTGACCTGG + Intergenic
1167963039 19:53122861-53122883 CTGGGGCCACCCTGGTGTAGTGG - Intronic
926013678 2:9429083-9429105 CTGGCTCAACCCTTCAGGAGTGG - Intronic
927104841 2:19814754-19814776 CTGTGTGAACCCTCCTGTAAGGG + Intergenic
933633032 2:84677873-84677895 CTGGGTGAACGCAACTGCAGAGG + Intronic
935329103 2:101963245-101963267 CTGGGTGAACCATACTGGGGAGG + Intergenic
947688980 2:232117169-232117191 CTGGGCCGACCCTGGTGTAGTGG + Intronic
1169157611 20:3346221-3346243 CTGGTACAACCCTTCTGAAGGGG + Intronic
1178887122 21:36493239-36493261 CTGGGTCCACCCCACAGTTGGGG + Intronic
1181491895 22:23265377-23265399 CTGGGCCAACCCTACTGAGCTGG - Intronic
1181903541 22:26174618-26174640 CTGGGTAAACACTGCTTTAGTGG + Intronic
1182153070 22:28044025-28044047 CTGGTTCAAACCCACTGTAGGGG + Intronic
1183816448 22:40305738-40305760 CTGGGACTGCCCTACTGTGGTGG + Intronic
953324144 3:41998432-41998454 CTGGGAAAAACCTATTGTAGGGG - Intergenic
954334772 3:49909823-49909845 CTGGAGCAACTCTACTTTAGGGG - Intronic
954923695 3:54213968-54213990 CTGGGTCAACCCTACTGTAGTGG + Intronic
957245536 3:77711598-77711620 CAGGGTCACCCCTACAGCAGGGG + Intergenic
965546429 3:169921004-169921026 CTGGGTCAATCCTTCGTTAGTGG + Intronic
968491353 4:892192-892214 CTGGGTCAGCTCCACTGCAGTGG + Intronic
976030799 4:80751424-80751446 CTGAGTCAACCCAACTGCAGAGG + Intronic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
982073842 4:151719360-151719382 CTGGGCCAGCCCTGCTGTGGGGG - Intronic
989188126 5:38644193-38644215 CTGGGTCCACCTTACTAGAGAGG + Intergenic
992124995 5:73630849-73630871 CTTGGTCAACACTACTGGAAAGG + Intronic
994198041 5:96941372-96941394 GTTGGGCAAACCTACTGTAGGGG + Intronic
995182272 5:109240034-109240056 CTGGGTCAAGCAGACTGAAGAGG - Intergenic
999729562 5:154466501-154466523 CTGCGTCAACCCTACTTCTGAGG + Intergenic
1001141907 5:169151492-169151514 CTGGGACAGCCCTCCTGTAAGGG + Intronic
1002089806 5:176797820-176797842 CTGCCTCAGCCCCACTGTAGCGG - Intergenic
1012848340 6:104418145-104418167 CTTGGTCAACCATACTTCAGAGG - Intergenic
1012867231 6:104632920-104632942 CTGTGCCAACACCACTGTAGGGG - Intergenic
1017650777 6:156579750-156579772 CTGGGTCAAATCTACTGATGAGG - Intergenic
1021013326 7:15499558-15499580 ATGGATCAACCCCACTGTAAGGG + Intronic
1035299254 7:157886759-157886781 CTGGGGCAGCCCCACTGTGGTGG - Intronic
1036486018 8:9179349-9179371 CTGGGTAAGCCCTACAGAAGTGG - Intergenic
1039962922 8:42263400-42263422 CTGGGTCACCGAAACTGTAGGGG + Intergenic
1061007201 9:127935008-127935030 CCGAGTCACCCCTACTGTACAGG + Intergenic
1061406972 9:130397719-130397741 CTGAGTCACCCCAGCTGTAGGGG + Intronic
1188692676 X:33149644-33149666 CTGGGTCTACCATGCTGAAGAGG + Intronic
1195443348 X:104921992-104922014 CTGGGACAACCCTCCAGTGGGGG - Intronic