ID: 954924838

View in Genome Browser
Species Human (GRCh38)
Location 3:54224454-54224476
Sequence TCACCCGTCTGTGGTCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954924838_954924840 11 Left 954924838 3:54224454-54224476 CCAGCTTGACCACAGACGGGTGA 0: 1
1: 0
2: 1
3: 15
4: 97
Right 954924840 3:54224488-54224510 CACTACAATGTTACAACACCTGG 0: 1
1: 0
2: 0
3: 3
4: 84
954924838_954924843 30 Left 954924838 3:54224454-54224476 CCAGCTTGACCACAGACGGGTGA 0: 1
1: 0
2: 1
3: 15
4: 97
Right 954924843 3:54224507-54224529 CTGGGACATCACTAAGTGATAGG 0: 1
1: 2
2: 10
3: 54
4: 252
954924838_954924841 12 Left 954924838 3:54224454-54224476 CCAGCTTGACCACAGACGGGTGA 0: 1
1: 0
2: 1
3: 15
4: 97
Right 954924841 3:54224489-54224511 ACTACAATGTTACAACACCTGGG 0: 1
1: 0
2: 1
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954924838 Original CRISPR TCACCCGTCTGTGGTCAAGC TGG (reversed) Intronic