ID: 954924839

View in Genome Browser
Species Human (GRCh38)
Location 3:54224463-54224485
Sequence ATGCGTTACTCACCCGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954924839_954924840 2 Left 954924839 3:54224463-54224485 CCACAGACGGGTGAGTAACGCAT 0: 1
1: 0
2: 3
3: 18
4: 131
Right 954924840 3:54224488-54224510 CACTACAATGTTACAACACCTGG 0: 1
1: 0
2: 0
3: 3
4: 84
954924839_954924841 3 Left 954924839 3:54224463-54224485 CCACAGACGGGTGAGTAACGCAT 0: 1
1: 0
2: 3
3: 18
4: 131
Right 954924841 3:54224489-54224511 ACTACAATGTTACAACACCTGGG 0: 1
1: 0
2: 1
3: 8
4: 95
954924839_954924843 21 Left 954924839 3:54224463-54224485 CCACAGACGGGTGAGTAACGCAT 0: 1
1: 0
2: 3
3: 18
4: 131
Right 954924843 3:54224507-54224529 CTGGGACATCACTAAGTGATAGG 0: 1
1: 2
2: 10
3: 54
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954924839 Original CRISPR ATGCGTTACTCACCCGTCTG TGG (reversed) Intronic