ID: 954924840

View in Genome Browser
Species Human (GRCh38)
Location 3:54224488-54224510
Sequence CACTACAATGTTACAACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954924838_954924840 11 Left 954924838 3:54224454-54224476 CCAGCTTGACCACAGACGGGTGA 0: 1
1: 0
2: 1
3: 15
4: 97
Right 954924840 3:54224488-54224510 CACTACAATGTTACAACACCTGG 0: 1
1: 0
2: 0
3: 3
4: 84
954924839_954924840 2 Left 954924839 3:54224463-54224485 CCACAGACGGGTGAGTAACGCAT 0: 1
1: 0
2: 3
3: 18
4: 131
Right 954924840 3:54224488-54224510 CACTACAATGTTACAACACCTGG 0: 1
1: 0
2: 0
3: 3
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954924840 Original CRISPR CACTACAATGTTACAACACC TGG Intronic