ID: 954924841

View in Genome Browser
Species Human (GRCh38)
Location 3:54224489-54224511
Sequence ACTACAATGTTACAACACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954924838_954924841 12 Left 954924838 3:54224454-54224476 CCAGCTTGACCACAGACGGGTGA 0: 1
1: 0
2: 1
3: 15
4: 97
Right 954924841 3:54224489-54224511 ACTACAATGTTACAACACCTGGG 0: 1
1: 0
2: 1
3: 8
4: 95
954924839_954924841 3 Left 954924839 3:54224463-54224485 CCACAGACGGGTGAGTAACGCAT 0: 1
1: 0
2: 3
3: 18
4: 131
Right 954924841 3:54224489-54224511 ACTACAATGTTACAACACCTGGG 0: 1
1: 0
2: 1
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954924841 Original CRISPR ACTACAATGTTACAACACCT GGG Intronic