ID: 954924843

View in Genome Browser
Species Human (GRCh38)
Location 3:54224507-54224529
Sequence CTGGGACATCACTAAGTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 2, 2: 10, 3: 54, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954924838_954924843 30 Left 954924838 3:54224454-54224476 CCAGCTTGACCACAGACGGGTGA 0: 1
1: 0
2: 1
3: 15
4: 97
Right 954924843 3:54224507-54224529 CTGGGACATCACTAAGTGATAGG 0: 1
1: 2
2: 10
3: 54
4: 252
954924839_954924843 21 Left 954924839 3:54224463-54224485 CCACAGACGGGTGAGTAACGCAT 0: 1
1: 0
2: 3
3: 18
4: 131
Right 954924843 3:54224507-54224529 CTGGGACATCACTAAGTGATAGG 0: 1
1: 2
2: 10
3: 54
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954924843 Original CRISPR CTGGGACATCACTAAGTGAT AGG Intronic