ID: 954924843 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:54224507-54224529 |
| Sequence | CTGGGACATCACTAAGTGAT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 319 | |||
| Summary | {0: 1, 1: 2, 2: 10, 3: 54, 4: 252} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 954924838_954924843 | 30 | Left | 954924838 | 3:54224454-54224476 | CCAGCTTGACCACAGACGGGTGA | 0: 1 1: 0 2: 1 3: 15 4: 97 |
||
| Right | 954924843 | 3:54224507-54224529 | CTGGGACATCACTAAGTGATAGG | 0: 1 1: 2 2: 10 3: 54 4: 252 |
||||
| 954924839_954924843 | 21 | Left | 954924839 | 3:54224463-54224485 | CCACAGACGGGTGAGTAACGCAT | 0: 1 1: 0 2: 3 3: 18 4: 131 |
||
| Right | 954924843 | 3:54224507-54224529 | CTGGGACATCACTAAGTGATAGG | 0: 1 1: 2 2: 10 3: 54 4: 252 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 954924843 | Original CRISPR | CTGGGACATCACTAAGTGAT AGG | Intronic | ||