ID: 954925611

View in Genome Browser
Species Human (GRCh38)
Location 3:54231760-54231782
Sequence CTTGTCAAGGCCAAGGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954925611 Original CRISPR CTTGTCAAGGCCAAGGTTAT TGG Intronic
909725310 1:78827992-78828014 ATGGGCAAGGCCAAGGCTATAGG + Intergenic
911126058 1:94342016-94342038 TTTGTTATGGGCAAGGTTATAGG - Intergenic
912222062 1:107689634-107689656 TTTGTGAAAGCCAAGGTGATGGG - Intronic
916058749 1:161085073-161085095 CACTCCAAGGCCAAGGTTATGGG - Intronic
917450312 1:175142530-175142552 CTTGTCAAGGCATAGGTTGCCGG + Intronic
918489783 1:185069207-185069229 CTTTGCAAGGCCAAGGTTGGCGG + Intronic
918687145 1:187431276-187431298 ATTGACAAGTCCAAGGTTACAGG - Intergenic
918886400 1:190199603-190199625 CTTGTGTAGTCTAAGGTTATTGG + Intronic
923859373 1:237877554-237877576 CTTGTCATGGCCAAGGTACTTGG + Intergenic
924322294 1:242862267-242862289 CTTTGCAAGGCCGAGGTTGTTGG + Intergenic
924584766 1:245352505-245352527 CTTGGCGAGGCCAAGGTTGATGG - Intronic
1068197230 10:53732412-53732434 CTTGGCAGGGGCAGGGTTATGGG + Intergenic
1068365888 10:56049586-56049608 CTTGTGAGGGCCAAGGTCCTTGG + Intergenic
1071660166 10:87492983-87493005 CTTTCCAAGGCCAAGGTGGTCGG - Intergenic
1071918247 10:90320640-90320662 CTTGCCAAGGCCAATGTCAAGGG + Intergenic
1079901703 11:26194807-26194829 CTTTGCAAGGCCAAGGCTAGTGG - Intergenic
1081199162 11:40195483-40195505 CTTGTCAGGGGCAAGGATGTGGG + Intronic
1084384742 11:68836230-68836252 CTTTGCAAGGCCAAGGTGAAAGG + Intronic
1088328019 11:108621809-108621831 CATGTCAATGCCTAGGTTTTTGG + Intergenic
1089701547 11:120247400-120247422 CTTGTCAGGGGCAAGATAATTGG + Intronic
1092371919 12:7923701-7923723 CTTTGGAAGGCCAAGGTTAGAGG - Intronic
1092569681 12:9708734-9708756 CTTGCCAAGGTCAAGGTCACTGG + Intergenic
1093369516 12:18350557-18350579 CTTTTAATGGCAAAGGTTATGGG - Intronic
1096775650 12:53961861-53961883 CTTGTCGAGGCCCAGTTTCTTGG - Intergenic
1099264425 12:80427363-80427385 CTCTTCAAAGTCAAGGTTATTGG + Intronic
1101213524 12:102558772-102558794 CTTGTAAAGCTCAAGGATATGGG - Intergenic
1101414774 12:104499507-104499529 CTTGCTGAGGCCAAGGTTATAGG - Intronic
1104062015 12:125276682-125276704 CAGGTCAAGGCCAAGGGCATAGG - Intronic
1105631921 13:22177844-22177866 CTTGGCAAGGGCAATTTTATGGG + Intergenic
1106857544 13:33869290-33869312 CTTGTAAAGGTCAAGGCTCTTGG - Intronic
1107089036 13:36456622-36456644 TTTGTTAAGGCTAAGATTATTGG - Intergenic
1110225388 13:73114211-73114233 CTTTTCAAGGCCAAGGTGGGTGG - Intergenic
1112248585 13:97756916-97756938 CAAGTCAAGGTCAAGGTTGTTGG + Intergenic
1117227022 14:53671705-53671727 ATTGAAAAGCCCAAGGTTATTGG - Intergenic
1118485834 14:66213767-66213789 CTTGTGAAGGCCAAGGCCCTTGG - Intergenic
1118523255 14:66611298-66611320 ATTTTCAAGGCCAAGGCCATTGG + Intronic
1202858939 14_GL000225v1_random:69189-69211 TTTGTCAAGGATATGGTTATAGG + Intergenic
1126209583 15:46085374-46085396 CTTGTCCAGGACAAAGATATAGG - Intergenic
1128642037 15:69346541-69346563 CTTTGCAAGGCCAAGGTGAGAGG - Intronic
1128993813 15:72281882-72281904 CTGGTCAAGACCAAGGTCACTGG + Intronic
1129829369 15:78658272-78658294 CTTGGGAAGGCCAAGGTGAGTGG - Intronic
1136127338 16:28193686-28193708 GTGAGCAAGGCCAAGGTTATTGG - Intronic
1141408765 16:83817601-83817623 CTTGTAAAGACCAAGGTAAGAGG - Exonic
1141914247 16:87083402-87083424 ATGGTCAAGGCCAAAGTTACTGG + Intergenic
1142766900 17:2069783-2069805 CTGGTCAAGGGCAAGGTGGTGGG - Intronic
1143391145 17:6560009-6560031 TTTGTCAAGGCCATGGTGATTGG - Intergenic
1143837374 17:9702928-9702950 CTGGTCATGGTGAAGGTTATGGG + Intronic
1148523752 17:48309399-48309421 ATTGTCAAGGCCATGCTTACTGG - Intronic
1151718557 17:75843598-75843620 CTGATCCAGGCCAAGGGTATGGG + Intronic
1151858780 17:76742900-76742922 CTTGTCAAGGCCAAAATTTTAGG - Intronic
1154358000 18:13637039-13637061 CTTTGCAAGGCCAAGGTGAGTGG - Intronic
1155777892 18:29791336-29791358 CTTTGCAAGGCCAAGGTGAGAGG - Intergenic
1156992940 18:43431928-43431950 CTTGTGAAGGCCATGGTTGTTGG - Intergenic
1159187230 18:64990846-64990868 CTTGTGAAGGCCTAGGATAATGG + Intergenic
1164817871 19:31220043-31220065 CTTGTCAAGGCCAAGGTGGATGG + Intergenic
1165241507 19:34472111-34472133 CTTGGCAAGGCCAAGGTGGGAGG - Intergenic
925632363 2:5907811-5907833 CTGGTCAGGGCTAAGGGTATCGG - Intergenic
926857280 2:17270859-17270881 CTTGGGAAGGCCAAGACTATGGG + Intergenic
927257931 2:21056606-21056628 CCTGAGAAGGCCAAGGTTAGCGG - Intergenic
929856652 2:45643488-45643510 CTTCCCAAGGCCAAGGTTGGAGG - Intergenic
930062553 2:47302447-47302469 CTTGGCAAGGGAAAGGTTATGGG + Intergenic
933015686 2:77123830-77123852 ACTGTCAAGGCCAAGGATAATGG - Intronic
934126424 2:88897277-88897299 CAGGTCAGGGCCAAGGTTATGGG + Intergenic
935627309 2:105181726-105181748 CATGTCAGAGCCAGGGTTATTGG - Intergenic
938588796 2:132717513-132717535 CTTCTCAAGGCCAAGGACTTTGG - Intronic
938626961 2:133120974-133120996 CTTATGATGGCAAAGGTTATTGG + Intronic
940047770 2:149427948-149427970 CTTGGCAAGGCTAGAGTTATAGG - Intronic
940717723 2:157246462-157246484 GTTGTCAGGGCCAAGGGTAGGGG + Intergenic
941955407 2:171199265-171199287 CTTTGCAAGGCCAAGGTGAAAGG + Intronic
948024966 2:234769469-234769491 CTTTTCAAGGCCAAGGTGGGAGG + Intergenic
1168895212 20:1319501-1319523 CTTGGCAATGCCAAAGGTATGGG - Exonic
1170773076 20:19351178-19351200 AGTGACAAGGCCAAGGTTCTGGG - Intronic
1172370415 20:34385304-34385326 CTTTGCAAGGCCAAGGTGAGCGG - Intronic
1173320031 20:41979089-41979111 CTTTTCAAGGCCACGCATATTGG + Intergenic
1173320516 20:41983388-41983410 CTTTTCAAGGCCATGCATATTGG - Intergenic
1174725712 20:52859618-52859640 CTTGCCAAGTCCCAGGTCATAGG - Intergenic
1175435545 20:58944981-58945003 TTTCTCAAGGCCAAGGTGAGTGG - Intergenic
1176055140 20:63141304-63141326 CTTGTCAAGGGCATCGTTAAAGG + Intergenic
1183042166 22:35190267-35190289 GGTGTCAAGCTCAAGGTTATGGG + Intergenic
1183258244 22:36776957-36776979 CTTGTCCAGGCCAGGGATTTAGG - Intergenic
949591492 3:5498989-5499011 CTTGTCAATGGCAAGGTTACTGG - Intergenic
951568900 3:24041414-24041436 ATGGTCAAAGCCAAGCTTATAGG + Intergenic
952161933 3:30702537-30702559 GTTGTGAGGGCCAAGGTTTTTGG + Intergenic
953394344 3:42555431-42555453 CTTTTCAAGGCCAAGGTGGGAGG - Intronic
954925611 3:54231760-54231782 CTTGTCAAGGCCAAGGTTATTGG + Intronic
955561261 3:60193586-60193608 CTTGTCAAGGCCATGGTTATAGG - Intronic
959247860 3:103898246-103898268 CTTGTCAATGCCAAATTGATGGG - Intergenic
961866571 3:129957595-129957617 ATAGCCAAGGCCAAGGTTAAGGG + Intergenic
964474702 3:157088354-157088376 CTTTTGAAGTCCAAGGTTGTCGG - Intergenic
964891083 3:161536203-161536225 CTTGCCATGGGCAAGGGTATAGG - Intergenic
965715288 3:171596206-171596228 ATTGGCAAGGCCAAGATTTTAGG + Intergenic
966252551 3:177882736-177882758 CTTCCCAAGGCAATGGTTATGGG - Intergenic
967806234 3:193716762-193716784 CTTGGCAATGCCAAGGTTCTGGG + Intergenic
968724172 4:2234446-2234468 CAGGTCAAGACCAAGGATATGGG - Intronic
972400212 4:38694724-38694746 CCTGTGAAAGCCAAGGTTACAGG - Exonic
975817709 4:78236198-78236220 GTTGTCAAGGCCAGGGAGATAGG + Intronic
977252112 4:94700849-94700871 CAGGTCAAGGGCAAGGTGATGGG - Intergenic
978764290 4:112388797-112388819 CTTGTCAAAGTCCAGCTTATTGG + Intronic
980452545 4:132993632-132993654 ATTACCAAGGCCAAGCTTATTGG + Intergenic
983253511 4:165372828-165372850 CTTGGCAAGGCCAAGGTGGGTGG - Intronic
983989579 4:174101367-174101389 TTTGTCAAGGCCACAGGTATTGG - Intergenic
986437658 5:7749998-7750020 CTTGTCAATGAAAAGGATATAGG + Intronic
987691324 5:21270291-21270313 CTTTGGAAGGCCAAGGTTAGAGG - Intergenic
994732708 5:103512356-103512378 TTTTTTAAGGCCAAGGATATAGG - Intergenic
995094726 5:108222392-108222414 GATGTTCAGGCCAAGGTTATAGG + Intronic
1000302371 5:159967828-159967850 CTTCTCAAGGCCATGGTCCTTGG + Intronic
1000863816 5:166488582-166488604 TTTCTCTAGGCCAAGGTTACTGG + Intergenic
1006083136 6:31579025-31579047 CTTTGCAAGGCCAAGGTGAGAGG + Intergenic
1007783752 6:44268762-44268784 TTTGGAAAGGCCAAGGTTAGGGG + Intergenic
1009949434 6:70378878-70378900 CTAGTGGAGGCCAAGGTCATGGG - Intergenic
1010089028 6:71957315-71957337 CTTTTCAAGAGCAAAGTTATAGG + Intronic
1024310726 7:47966581-47966603 CTTGTCAGGACCAAGGGTCTGGG + Intronic
1027831825 7:83186573-83186595 ATTTTCAAGGTCAAGATTATAGG - Intergenic
1030194589 7:106841143-106841165 CCTGTCTAGGTCAAGGTAATGGG - Intergenic
1030488134 7:110197434-110197456 CTTGGGAAGGCCAAGGTTGGAGG - Intergenic
1033607806 7:142940220-142940242 CTGGTGAAGGCTAAGGATATGGG + Intronic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1035599882 8:891141-891163 GTTGCCAAGGCCAAGGATGTGGG + Intergenic
1037376039 8:18230070-18230092 CTTTTGAAGGCCAAGGTGAGAGG + Intergenic
1041930199 8:63278172-63278194 CTTATTAAGAGCAAGGTTATGGG - Intergenic
1043566992 8:81559469-81559491 CTTTTCTAGGCCAGGGTGATCGG + Intergenic
1043925936 8:86037193-86037215 CTTTGGAAGGCCAAGGTCATAGG + Intronic
1054146484 9:61565403-61565425 CTTTTGGAGGCCAAGGTTGTAGG - Intergenic
1058898749 9:109422956-109422978 CAGGTTAATGCCAAGGTTATGGG + Intronic
1060938944 9:127532350-127532372 CTTTTCAAGGCCAAGGTAGGTGG + Intronic
1203740533 Un_GL000216v2:173583-173605 CTTGTCAAGGCTATGCTTACAGG - Intergenic
1187429828 X:19211789-19211811 TTTGTCAAGTCAAAGGATATAGG - Intergenic
1189520985 X:41767730-41767752 CTTGCCTAGGTCAGGGTTATGGG + Intronic
1189606210 X:42680856-42680878 CTTGGCTAGTCCAAGGCTATGGG + Intergenic
1192847499 X:74921637-74921659 CTTTTCAAACCCAAGGTCATAGG - Intronic
1195864834 X:109420182-109420204 CTTGTCTAGTCCAAGATTCTGGG - Intronic
1196189819 X:112782548-112782570 CATGTCAAGGCAACGCTTATTGG + Exonic
1198810527 X:140531559-140531581 CTTTTCAAGCCCTAGGTGATGGG + Intergenic