ID: 954929619

View in Genome Browser
Species Human (GRCh38)
Location 3:54269703-54269725
Sequence ACCAGGTGTCCAGAGATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954929615_954929619 11 Left 954929615 3:54269669-54269691 CCAGGGAAGATGTGGGGAAGGAG 0: 1
1: 0
2: 9
3: 68
4: 512
Right 954929619 3:54269703-54269725 ACCAGGTGTCCAGAGATGAATGG 0: 1
1: 0
2: 0
3: 19
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954929619 Original CRISPR ACCAGGTGTCCAGAGATGAA TGG Intronic
900456838 1:2779162-2779184 CCCAGGTGTCCACCGATGGATGG - Intronic
900889789 1:5441583-5441605 ACCAGGTGTCTGGGGATGGAAGG + Intergenic
901135514 1:6991134-6991156 ACCAGATGTCCATGAATGAATGG - Intronic
902213773 1:14922410-14922432 ACCAAGTGACCAGAGATGCTGGG - Intronic
902838755 1:19062360-19062382 GCCAGGTGTCCCTGGATGAAGGG - Intergenic
903229741 1:21914526-21914548 GCCAGGTGTCCAGGGACGACTGG + Intronic
904560621 1:31394897-31394919 AACAGGTGTCCCGAGAGGAGAGG + Intergenic
905437703 1:37969245-37969267 CACTGGTGTCCAGAGCTGAAGGG - Intronic
906694228 1:47813344-47813366 TCCAGGTGGCCAGGGATGGAAGG + Intronic
908313929 1:62914003-62914025 AACAGGAGTCAAAAGATGAAAGG - Intergenic
910993226 1:93077379-93077401 ACCAAGTGTTCAGAGATTTAAGG - Intergenic
912362212 1:109104324-109104346 TCCAGTTCTCCAGAGGTGAAAGG - Intergenic
913383153 1:118231711-118231733 TCCAGAGGTCCAGAGGTGAATGG - Intergenic
915858869 1:159421482-159421504 ACCAGATGTGCAGATATCAATGG - Intergenic
920398759 1:205664273-205664295 ACCAGGGATCCAGAGGTGACTGG + Intronic
920560690 1:206936355-206936377 AGCAGGTGACCAAAGATGCAGGG + Intronic
920571149 1:207018903-207018925 ACCAGGTGTCAAAGGATGGAAGG + Exonic
921446560 1:215254084-215254106 TTCAGGTCTCCAGAGAGGAAGGG + Intergenic
922696730 1:227734807-227734829 ACCACGTCTCCTGAAATGAAAGG + Exonic
1065145518 10:22764182-22764204 ACAACGAGTCCAGAGATGAGTGG + Intergenic
1065315592 10:24460564-24460586 CCCATGTGTCAAGAGAAGAAAGG - Intronic
1069304335 10:66949837-66949859 ACAATGTGTGCAGAGAGGAATGG + Intronic
1069948415 10:72002850-72002872 ACCAGCTGTCCAAAAATCAATGG - Intronic
1070671667 10:78381631-78381653 ACCAGGTGGGCACATATGAAAGG - Intergenic
1071526589 10:86363095-86363117 ACCAGGGTTCCCGAGCTGAAAGG + Intronic
1073759488 10:106613997-106614019 ACAAAGGGTCCAGTGATGAAGGG - Intronic
1075552853 10:123405856-123405878 ATCAGTTGTAGAGAGATGAAGGG - Intergenic
1076236595 10:128868352-128868374 TCCAGGCGTCCAGAGGAGAATGG + Intergenic
1077017748 11:404417-404439 ACCAGGGACCCAGAGAGGAAGGG + Intronic
1082635041 11:55584608-55584630 ACCAGGTGAGCTGACATGAAAGG - Intergenic
1083269236 11:61562965-61562987 ACCAGCTGCCCAGAGGGGAACGG + Intronic
1084595905 11:70116909-70116931 ACCAGGTGCACAGAGAACAATGG + Intronic
1087438740 11:98156251-98156273 ACCAGGTGTACAGTAAGGAATGG - Intergenic
1087810908 11:102608176-102608198 ACCAGGTCTCCAGGGCTCAAAGG + Intronic
1089856609 11:121550691-121550713 ACCATGTCTCAAGAAATGAAAGG - Intronic
1091213849 11:133887438-133887460 GCCACGTGTCCAGAGGTGGAAGG - Intergenic
1092047056 12:5439063-5439085 ACAGGGTGTGCAGAGCTGAAAGG + Intronic
1094189539 12:27683495-27683517 AACAGTTGTCCAGAGTGGAAAGG - Intronic
1096712516 12:53467813-53467835 TCCAGCTCTCCAGAGGTGAAAGG + Exonic
1097961464 12:65535599-65535621 AGCAGGATTACAGAGATGAATGG + Intergenic
1099785022 12:87251126-87251148 CCCAAGTTTCCAGACATGAAGGG + Intergenic
1100514536 12:95314393-95314415 ACAAGGTGGTCAGACATGAAAGG + Intergenic
1103548281 12:121717222-121717244 ATCAGGTTTCCAGTGATGCAAGG - Intronic
1104906106 12:132214281-132214303 AGCAGGAGCCCAGGGATGAAGGG + Intronic
1105220611 13:18322859-18322881 ACCAGGACTTCAGAGAGGAATGG - Intergenic
1106376782 13:29196843-29196865 CTCAAGTGTCCACAGATGAAAGG - Intronic
1106718104 13:32412252-32412274 ATCTGGTGACCATAGATGAAGGG - Intronic
1107363549 13:39645572-39645594 ACCCGGTATTCAAAGATGAATGG + Intergenic
1108542550 13:51457122-51457144 TCCACTTGTCCGGAGATGAATGG + Intergenic
1108696428 13:52906421-52906443 ACCAGGTGTACTGAGTTGAAAGG - Intergenic
1111875114 13:93883226-93883248 ACCAGGCACCCAGAGATAAATGG + Intronic
1111875245 13:93885261-93885283 ACCAGGCACCCAGAGATAAATGG - Intronic
1113269039 13:108652789-108652811 AGCAGATGTCCATAGATGAATGG - Intronic
1117002191 14:51382148-51382170 GGCTGGTGTCCAGTGATGAAAGG + Intergenic
1119468068 14:74875358-74875380 ACCAGGAGCCCAGAGAGGTAAGG + Intergenic
1119643470 14:76331079-76331101 ACCAGATGGCCAAAGAGGAAGGG + Intronic
1120380921 14:83778549-83778571 CCAAGGTATCCAGAGATGATAGG + Intergenic
1120497756 14:85257728-85257750 ACCAAGTGTCCATGGATGAGGGG - Intergenic
1121628048 14:95401126-95401148 ATCAGGTGTCCAGACATCACTGG + Intergenic
1122138125 14:99646136-99646158 ACCAGGTGTGCACAGAAGCAGGG - Intronic
1122589977 14:102841720-102841742 ACCAGGTATGCAGAGAAGCAAGG + Intronic
1123654831 15:22506707-22506729 ACCAAGTGTCCAAAAAAGAAAGG - Intergenic
1123844761 15:24288046-24288068 AACTGGCTTCCAGAGATGAATGG + Intergenic
1123936832 15:25198147-25198169 AACAGTTGTCCAGACAGGAAAGG + Intergenic
1127873637 15:63093652-63093674 AGCAGGAGGTCAGAGATGAAAGG + Intergenic
1129691417 15:77715805-77715827 AGCACTTGTCCTGAGATGAATGG - Intronic
1130051909 15:80490688-80490710 ACCAGGTCTTCACAGATGAAGGG + Intronic
1130068085 15:80622288-80622310 ACCAAGTGTTGACAGATGAATGG + Intergenic
1131172783 15:90190468-90190490 ACCAGGTGACCTGAGGTGATGGG + Intronic
1131404948 15:92156535-92156557 ACAAGGGGTCCAGGAATGAAAGG + Intronic
1136086654 16:27890198-27890220 ACCAGGTGTCCAGAAGAGGACGG + Intronic
1136120324 16:28128752-28128774 CCAAGTTGTCCAGAGATGGAAGG - Intronic
1136587890 16:31199557-31199579 TCAAGGTGTCCAGAGATAAAGGG + Intergenic
1137386634 16:48048301-48048323 GCCAGGTAACCAGAGATGATGGG - Intergenic
1138081992 16:54099564-54099586 ATCATGTGACCAGAGATCAAAGG + Intronic
1139031595 16:62888897-62888919 ATCAAGTGTCCAATGATGAATGG - Intergenic
1146056853 17:29585585-29585607 TCCAGGTGACCTGAGAAGAATGG + Intronic
1146200390 17:30852383-30852405 ACCAGGGGTCCACAGAGAAATGG - Intronic
1149428707 17:56579351-56579373 ACCAGGAGTCCCGAAGTGAAGGG - Intergenic
1149680511 17:58503848-58503870 AACAGCTGTCCAGAGGTGCAGGG + Exonic
1152285451 17:79410080-79410102 TCCAGGTGTGCAGAGCTGAAGGG - Intronic
1153762983 18:8349678-8349700 ACCAGGAGTCTGAAGATGAATGG - Intronic
1154953909 18:21236909-21236931 ACCAGTTGACCACAGATGCATGG + Intergenic
1156767393 18:40674001-40674023 ACCAGTTGGCCAGAGCAGAAGGG + Intergenic
1158656267 18:59337786-59337808 ACCTGATGTCTAGAGATTAAAGG - Intronic
1159382260 18:67675465-67675487 ACCATGTGTGCAGAAATGAGGGG + Intergenic
1160250329 18:77198014-77198036 CCCAGGTGTGCAGAGAGGAAAGG + Intergenic
1161239646 19:3215084-3215106 AACCAGTGTCCAGAGATGGACGG + Intergenic
1161489245 19:4552773-4552795 AGCCGGTGCCCAGAGAGGAACGG - Intronic
1162788410 19:13050683-13050705 CCCAGGGGTCCAGAGAGTAATGG - Intronic
1162853655 19:13451377-13451399 AAAAGGTGTCCAGTGAAGAAGGG + Intronic
1168382982 19:55939886-55939908 TCCAGGTGTCCAGAGGTCTAGGG + Intergenic
1168506058 19:56936082-56936104 ACCCAGTGTCCAGTGATGGATGG - Intergenic
928536675 2:32247783-32247805 ACCAGGTGTCAGGACTTGAAAGG - Intronic
928669197 2:33583428-33583450 ACCCAGTGGCCAGAGATGAGTGG + Intergenic
931140186 2:59448921-59448943 ACTAAGAGTCCAGGGATGAATGG + Intergenic
932231699 2:70088527-70088549 TCCAGCTCTCCAGAGGTGAAAGG + Exonic
933665756 2:84963597-84963619 ACCAGGAGTGCAGGGTTGAAGGG + Intergenic
935810526 2:106792824-106792846 ATCAGGTTGCCAGATATGAATGG - Intergenic
936437701 2:112522447-112522469 ACCACGTGTCCAGCCATGACAGG - Intronic
936595297 2:113841500-113841522 ACCAGGTTACCAGAGACCAAGGG + Intergenic
936785812 2:116093661-116093683 ACCAGATGTGCAGATATAAATGG - Intergenic
937702749 2:124882321-124882343 ACCAGGTGTGCTGAGATGACAGG + Intronic
937939151 2:127271718-127271740 GCCAGGAGCCCAGAGATGAGAGG + Intronic
938953383 2:136277686-136277708 GCCAGGTGTCCAGAGCTATATGG + Intergenic
940960142 2:159776281-159776303 CCCAAGTGTCCACTGATGAAGGG - Intronic
941352156 2:164450074-164450096 TGCAGGTCTCCAGAGGTGAAAGG + Intergenic
947464561 2:230330302-230330324 ACCAGGTGGCCATAGAGGCAGGG + Intronic
947604046 2:231472418-231472440 ATCAGGAGGCCAGAGATGGAGGG - Intronic
948203990 2:236151916-236151938 ATCAAGTTTCCAGAGATGCATGG + Intergenic
948251195 2:236531304-236531326 ACCTGCTCTCCACAGATGAAGGG - Intergenic
948422590 2:237869655-237869677 CCCACGTGTCCATGGATGAATGG - Intronic
1170684148 20:18553879-18553901 ACCAGATGTGCGGAGATGAGAGG + Intronic
1171010944 20:21509131-21509153 CTCAGGTTTCCAGAGAGGAAGGG - Intergenic
1172632555 20:36388858-36388880 AAGAGGTGTCCAGAGCTGAAAGG + Intronic
1174422094 20:50405754-50405776 AACAGGAGTCCAGAGATGCCAGG - Intergenic
1175919043 20:62441486-62441508 CCCAGGTGTCTGGAGCTGAAGGG + Intergenic
1175936162 20:62515015-62515037 GCCAGGTGCCGGGAGATGAACGG + Intergenic
1178977740 21:37234044-37234066 AGCAGGTGCCCAGCGAGGAAGGG - Intronic
1179438180 21:41376155-41376177 ATTAGGTGTGCAGAGATGACAGG - Intronic
1181003497 22:19998820-19998842 ACCAGGTGTGCCGAGAGGACTGG + Intronic
1181443492 22:22950912-22950934 ACAAGGTGGCCAGTGCTGAATGG + Intergenic
1182279488 22:29209489-29209511 CCGAGGTTTCCACAGATGAAGGG - Intronic
1183187003 22:36297960-36297982 ACCAGATGGACAGACATGAAAGG - Intronic
1184334340 22:43844613-43844635 ACCAGGTGTGCAGAGCTCAGAGG - Intronic
1184775455 22:46620772-46620794 GCCAGGGGTCCAGTGAGGAAGGG + Intronic
1184837294 22:47031574-47031596 CGCAGGTGCCCAGAGATGCAAGG + Intronic
1185092465 22:48783765-48783787 GCCAAGTGTCCAAGGATGAAAGG + Intronic
949663718 3:6312320-6312342 AGCATGTGTCCAGATATGAGAGG - Intergenic
950012784 3:9734755-9734777 ACCAGTTTTCCAGAGCTGCAAGG - Intronic
950331351 3:12158610-12158632 ACCAGGAGTCCAGAGGAAAAGGG - Intronic
950540847 3:13611673-13611695 CCCAAGTGTCCATCGATGAATGG - Intronic
952087593 3:29845007-29845029 AGCAGGAGATCAGAGATGAAAGG + Intronic
953862055 3:46552830-46552852 ACCAGGTAAACAGAGATCAATGG - Intronic
954929619 3:54269703-54269725 ACCAGGTGTCCAGAGATGAATGG + Intronic
954948186 3:54445096-54445118 ACCAGGTGTCCAATGACAAATGG + Intronic
956284821 3:67597469-67597491 ACCAGGAATGCAAAGATGAATGG + Intronic
956673115 3:71709866-71709888 ACCAGTTTTACAGAGATGAAAGG + Intronic
957482445 3:80816139-80816161 ACCAGGATTCCAGAGGTCAATGG - Intergenic
960349114 3:116572376-116572398 ACCTGGTGTCCAGTGATTGAGGG - Intronic
960875945 3:122295527-122295549 ACCACGTGTGCACAGAGGAAAGG - Intergenic
962289559 3:134122657-134122679 ACCAGATGTGCAGATATCAATGG - Intronic
963657177 3:148069488-148069510 ACCAGCTGGGCAGAGATGCATGG - Intergenic
965921969 3:173927913-173927935 ACCAGGTCTTCAGAGAAGTAAGG - Intronic
966768984 3:183487088-183487110 ACAAGGTTTCCAGTGATTAAAGG + Intergenic
969203561 4:5624709-5624731 ACCAGTGGCTCAGAGATGAATGG + Intronic
969328158 4:6455881-6455903 AGCAGGTGGTCAGAGATGCAAGG - Intronic
969405440 4:6988319-6988341 AGCAGGTGCCCAGAAATGATAGG - Intronic
970585472 4:17510819-17510841 CCCAGGTCTTCAGAGATGCATGG - Intronic
971676586 4:29637846-29637868 AACATGTTTCCAAAGATGAATGG - Intergenic
972974170 4:44613232-44613254 GCCATGTGTACAGAGAGGAAAGG + Intergenic
973052257 4:45610476-45610498 ACCAGGTGAGCTGACATGAAAGG - Intergenic
973852455 4:54974706-54974728 ATCAGGTGGCCAGAGATAGATGG - Intergenic
974102626 4:57434584-57434606 AGCAGGTGTACAAAGAGGAAAGG + Intergenic
977452101 4:97212036-97212058 ACCTGGTGTCCTGAGATGCTGGG + Intronic
977827315 4:101548956-101548978 ACCATGAGTACAGAGAAGAAAGG - Intronic
980514789 4:133841550-133841572 ACCAGGTGTGCAGATAGGAGTGG + Intergenic
982321273 4:154079686-154079708 GCCTGCTGTCCAGTGATGAACGG + Intergenic
982383158 4:154771475-154771497 ACCACTTTTCCAGTGATGAAGGG + Intergenic
982910248 4:161132477-161132499 AGCAGGTGGCCAAAGATTAATGG + Intergenic
983729831 4:170979271-170979293 ACCTGGTAGCCAAAGATGAAGGG - Intergenic
983916084 4:173292762-173292784 ATCAGCTGCACAGAGATGAAAGG - Intronic
984233489 4:177129420-177129442 ACCAGATGTGCAGATATCAATGG - Intergenic
984357058 4:178674902-178674924 ACCAGTTGTCCACATATGCATGG - Intergenic
985171555 4:187155341-187155363 GCCAGGTGGCCAAAGATGATGGG - Intergenic
986007564 5:3680902-3680924 ACCATGTGTCCTCAGATCAATGG - Intergenic
986028073 5:3869512-3869534 CCCAGGTGCCCATGGATGAATGG + Intergenic
986168418 5:5295702-5295724 ATCTAGTGTCCAGAGATGAACGG + Intronic
986977649 5:13411355-13411377 ACCAGATGTGCAGAGATCAATGG + Intergenic
990185262 5:53204146-53204168 ACCAGGTGAGCTGACATGAAAGG - Intergenic
996104068 5:119478089-119478111 ACCAGCTGGGGAGAGATGAATGG + Intronic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
999215078 5:149926313-149926335 ACCAAGTGTCCATATATGTATGG - Intronic
999909538 5:156182639-156182661 ACCAGGTGACCATATATGAATGG - Intronic
999938548 5:156515773-156515795 ACCAAGTTTCCAGAGGGGAAGGG + Intronic
1000797205 5:165679659-165679681 AAAAGGTGTCTAGAGATGGATGG - Intergenic
1002560006 5:180074803-180074825 ACCAAGTGTCCTATGATGAATGG - Intergenic
1006628500 6:35414499-35414521 ATCATGTGTCCAGAGCAGAAGGG + Intronic
1006785431 6:36663397-36663419 ACGAGCTTTCCAGAGATGACAGG + Intergenic
1007947840 6:45841632-45841654 AAAAGATGTCCAGAGATGATGGG - Intergenic
1008141019 6:47832108-47832130 ACCAGGGCTTCAGAAATGAATGG + Intronic
1011946760 6:92914392-92914414 ACCAGTTGGCCATAGATGAATGG - Intergenic
1012935884 6:105366684-105366706 CCCAAGTGCCCAGGGATGAATGG + Intronic
1012939765 6:105403601-105403623 ACCAGGGGTCCTGGGATGAAGGG - Intergenic
1014896020 6:126899932-126899954 ACAAGGAGACCAGAGGTGAATGG + Intergenic
1018214228 6:161511439-161511461 CCCAGGAGTCTAGAAATGAAGGG - Intronic
1018852803 6:167653312-167653334 AACGGGCGTCCAGAGATGCAAGG - Intergenic
1019560819 7:1656138-1656160 ACCAGGTGCACAGAGAGGTATGG + Intergenic
1021300792 7:18970762-18970784 ACCCGGTGTGTAAAGATGAAAGG + Intronic
1031489557 7:122370068-122370090 ACCAGGAGAAGAGAGATGAAAGG - Intronic
1031923343 7:127616955-127616977 ACCAGGGTTCCAGGCATGAAAGG - Intergenic
1033208458 7:139442373-139442395 ACCAGATGTCAGGAGTTGAAGGG - Intergenic
1034029515 7:147744741-147744763 AGCAGGTGTGCACAGAGGAAAGG - Intronic
1034867893 7:154657002-154657024 AGGAGGTGCCCAGAGATGAGTGG + Intronic
1036270332 8:7297690-7297712 CCCAGGTGCCCAGCGTTGAACGG + Intergenic
1036659886 8:10701079-10701101 AGCTGGGGCCCAGAGATGAAAGG - Intronic
1037229289 8:16635776-16635798 GCTAGTTTTCCAGAGATGAAGGG + Intergenic
1037679584 8:21085499-21085521 ACCAAGTGCCAAGAAATGAAAGG + Intergenic
1037684226 8:21124793-21124815 ACCATGTCTCCAGAGCTGGAGGG + Intergenic
1038884543 8:31648802-31648824 ACCAGGTGTCCACTGATGGATGG - Intronic
1040523405 8:48197214-48197236 TTCAGTTGTTCAGAGATGAAGGG + Intergenic
1041692509 8:60702831-60702853 ACCAGCTGACCAGAGATGCAGGG - Intronic
1045542641 8:103101302-103101324 ACCAGGTTTCCAGAGCTGATGGG + Intergenic
1050001587 9:1083266-1083288 ACTGTGTATCCAGAGATGAAAGG + Intergenic
1050240708 9:3631515-3631537 ACAAGAAGTCCAGAGATGAATGG - Intergenic
1053002223 9:34583535-34583557 ACCTGGTGTCCAGAGCTTGAGGG - Intronic
1053480696 9:38414418-38414440 AGCAGGGGTCCAGAGGGGAAGGG + Intronic
1054948537 9:70823406-70823428 ACCAGGTGTTCAGTGAGGAGCGG - Intronic
1055445404 9:76377417-76377439 ACCAGGTCTGCAGATATGACTGG - Intergenic
1057447922 9:95131423-95131445 ACCTTGTGGCCAGAGATGAAGGG - Intronic
1059370900 9:113834010-113834032 ACCAATTGACCATAGATGAATGG - Intergenic
1062727629 9:138084618-138084640 ACCAGATGTACAGACATTAAGGG + Intronic
1187921594 X:24208166-24208188 ACCAGGTTTACAGAGATCACAGG - Intronic
1188038548 X:25345352-25345374 TCCAGGGTTCCTGAGATGAAGGG + Intergenic
1188487880 X:30703317-30703339 AGCTGGTGTTCAGAGATGACTGG + Intronic
1188752612 X:33922796-33922818 ACCATGAGAACAGAGATGAAAGG - Intergenic
1192840604 X:74850769-74850791 ACCAGATGTGCAGATATCAATGG + Intronic
1195803695 X:108738077-108738099 ACCAGGTTTGCAAAGAGGAATGG + Intergenic
1199276808 X:145953836-145953858 CCCAAATGTCCAAAGATGAATGG - Intergenic
1201257270 Y:12121007-12121029 ACAAGGTGTCATGAGATGACTGG + Intergenic
1201359279 Y:13128732-13128754 ACCAGGTGTCCAGAACCAAATGG + Intergenic
1201515487 Y:14815361-14815383 GCAAGGGGTCCAGGGATGAATGG + Intronic