ID: 954938020

View in Genome Browser
Species Human (GRCh38)
Location 3:54344754-54344776
Sequence CTCCATCTTAATTAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2029
Summary {0: 1, 1: 99, 2: 382, 3: 770, 4: 777}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954938016_954938020 7 Left 954938016 3:54344724-54344746 CCAGCTGTCAGAGGTGTGTGAAC 0: 1
1: 4
2: 22
3: 79
4: 223
Right 954938020 3:54344754-54344776 CTCCATCTTAATTAGGAGCTGGG 0: 1
1: 99
2: 382
3: 770
4: 777
954938015_954938020 8 Left 954938015 3:54344723-54344745 CCCAGCTGTCAGAGGTGTGTGAA 0: 1
1: 1
2: 5
3: 55
4: 265
Right 954938020 3:54344754-54344776 CTCCATCTTAATTAGGAGCTGGG 0: 1
1: 99
2: 382
3: 770
4: 777

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954938020 Original CRISPR CTCCATCTTAATTAGGAGCT GGG Intronic
Too many off-targets to display for this crispr