ID: 954943218

View in Genome Browser
Species Human (GRCh38)
Location 3:54393831-54393853
Sequence GTACCCTGCTTCCCTAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 3, 2: 7, 3: 37, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954943216_954943218 -1 Left 954943216 3:54393809-54393831 CCCTACTGGCTGAAGAACTGTAG 0: 1
1: 0
2: 2
3: 11
4: 157
Right 954943218 3:54393831-54393853 GTACCCTGCTTCCCTAGAACTGG 0: 1
1: 3
2: 7
3: 37
4: 95
954943215_954943218 4 Left 954943215 3:54393804-54393826 CCTTGCCCTACTGGCTGAAGAAC 0: 1
1: 0
2: 0
3: 10
4: 143
Right 954943218 3:54393831-54393853 GTACCCTGCTTCCCTAGAACTGG 0: 1
1: 3
2: 7
3: 37
4: 95
954943217_954943218 -2 Left 954943217 3:54393810-54393832 CCTACTGGCTGAAGAACTGTAGT 0: 1
1: 0
2: 0
3: 8
4: 113
Right 954943218 3:54393831-54393853 GTACCCTGCTTCCCTAGAACTGG 0: 1
1: 3
2: 7
3: 37
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954943218 Original CRISPR GTACCCTGCTTCCCTAGAAC TGG Intronic
901781601 1:11598160-11598182 GCCCCCTGGTTCCCCAGAACTGG - Intergenic
903665898 1:25007258-25007280 GTTTCCTCCTTCCCTAGGACGGG - Intergenic
906061000 1:42948479-42948501 GTCCCCTGCTTCCCTGCACCTGG - Intronic
909922610 1:81400818-81400840 GTACTCTACTTCCCTGGAGCTGG - Intronic
910975505 1:92901847-92901869 GTACCCTGCTTCCCTGGAACTGG - Intronic
913300742 1:117366953-117366975 GTACCCTGCCTCCCCAGGCCTGG - Intergenic
916207089 1:162325574-162325596 GAACCCTTCTTCCCGAGACCAGG + Intronic
919955519 1:202410974-202410996 TTAGCCTGCTTCCCAAGAAAAGG + Intronic
920209787 1:204319924-204319946 GTACCATGATTCCATTGAACTGG - Intronic
920834967 1:209502314-209502336 ACACCCTGCTTCCCTGGAGCTGG - Intergenic
1065050726 10:21788481-21788503 GTACCCTGCTTCTCTGGAGCTGG + Intronic
1067023813 10:42826618-42826640 GAACCCTGCTTCCTTGGAACTGG - Intronic
1068100089 10:52542058-52542080 GTCAGCTGCTTCCCTAGCACAGG - Intergenic
1071327340 10:84530220-84530242 GTACTATCCTTCCTTAGAACTGG - Intergenic
1072395249 10:95032990-95033012 GTACACTGCTTCCCTGGATAAGG - Intergenic
1073324041 10:102632287-102632309 TTACCCTGCTCCCCCAGAACAGG - Exonic
1077755771 11:5025815-5025837 ATACCCTGCTTCCCAACAAGTGG + Intergenic
1077888120 11:6401183-6401205 GTCCCCTGCCTCCCTTTAACCGG + Intronic
1078438615 11:11345646-11345668 CTGCCCTGCTTCCCCAGCACAGG - Intronic
1081152369 11:39648154-39648176 GCACCCTGCTGCCCTGGAACTGG + Intergenic
1081986134 11:47305775-47305797 GTACCCTGCTTCCCTGGAACTGG - Intronic
1084709990 11:70838130-70838152 GAACACTGCCTCCCTACAACTGG + Intronic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085539461 11:77253512-77253534 GTACCCTGCTTCCCTGGAGCTGG - Intronic
1085789894 11:79488025-79488047 GTACCCTGGTGCCCCAAAACAGG + Intergenic
1087171439 11:95053488-95053510 GTACTCTGCTTCACTGGAACTGG - Intergenic
1088021519 11:105125389-105125411 GTACCCTGCTTCTCTGCATCTGG + Intergenic
1093104258 12:15066616-15066638 TTTCCCTGTTTCCCTAGAACTGG + Intergenic
1097157886 12:57026054-57026076 GTACCCTGCTCCTCTAGGCCAGG - Intronic
1098326846 12:69312228-69312250 GTACCCTGCTTTCCTGGAGCTGG + Intergenic
1098514498 12:71358421-71358443 TTACCCTGCTTCCCTGGAGCTGG + Intronic
1098560376 12:71865671-71865693 GTACCTTGCTTCCCTGGAGCTGG - Intronic
1100431988 12:94539094-94539116 GTGGCCAGCCTCCCTAGAACAGG - Intergenic
1102903315 12:116655934-116655956 TGACCCTGCTACCCTGGAACTGG + Intergenic
1113705009 13:112424559-112424581 GAACCCTGCTTCCATGGCACAGG + Intronic
1119601517 14:75980050-75980072 GTATTCTTCTTCCCAAGAACTGG + Intronic
1122411971 14:101530135-101530157 GTTCCCTGTAGCCCTAGAACTGG - Intergenic
1122519357 14:102332522-102332544 GTCCCCTCCATCCCTAGAACAGG - Intronic
1123424959 15:20163655-20163677 GAACCCTGCTTCCTTGGAACTGG - Intergenic
1123534183 15:21170188-21170210 GAACCCTGCTTCCTTGGAACTGG - Intergenic
1127892129 15:63262194-63262216 CTACCCCACTTCCCTAGAGCAGG - Intronic
1131801148 15:96070671-96070693 GCACGCTGCTTCTGTAGAACTGG - Intergenic
1131918842 15:97301312-97301334 GTACCCTGCCTCCTGAGAAATGG - Intergenic
1132199843 15:99943870-99943892 GTACCTTGCTTCTCTGGAACTGG - Intergenic
1132815744 16:1825895-1825917 GCATCTTGCTTCCCTTGAACTGG + Intronic
1135952706 16:26930202-26930224 GTACCCTTCTTTTCTAGCACTGG - Intergenic
1136859899 16:33692090-33692112 GAACCCTGCTTCCTTGGAACTGG + Intergenic
1137359193 16:47797574-47797596 GTACCCTGATTCCCTGGAACTGG - Intergenic
1203121404 16_KI270728v1_random:1540269-1540291 GAACCCTGCTTCCTTGGAACTGG + Intergenic
1143595697 17:7912326-7912348 GTTACCTGGGTCCCTAGAACAGG - Exonic
1143910335 17:10243720-10243742 GTACCCAGCCTCCCTACTACGGG - Intergenic
1144876489 17:18399929-18399951 GTGCCCTGCTTCCCCAGTCCGGG + Intergenic
1145155737 17:20544491-20544513 GTGCCCTGCTTCCCCAGTCCGGG - Intergenic
1145761154 17:27426074-27426096 GTGCCCTGCTTCCCCAGCCCAGG + Intergenic
1146843181 17:36168558-36168580 GTGCCCTGCTTCCCCAGCCCGGG - Intronic
1146855491 17:36256499-36256521 GTGCCCTGCTTCCCCAGCCCGGG - Intronic
1146865130 17:36331876-36331898 GTGCCCTGCTTCCCCAGCCCGGG + Intronic
1146871397 17:36380410-36380432 GTGCCCTGCTTCCCCAGCCCGGG - Intronic
1146878757 17:36431492-36431514 GTGCCCTGCTTCCCCAGCCCGGG - Intronic
1146882702 17:36452638-36452660 GTGCCCTGCTTCCCCAGCCCGGG - Intergenic
1147067989 17:37932470-37932492 GTGCCCTGCTTCCCCAGCCCGGG + Intronic
1147074283 17:37981034-37981056 GTGCCCTGCTTCCCCAGCCCGGG - Intronic
1147079520 17:38012025-38012047 GTGCCCTGCTTCCCCAGCCCGGG + Intronic
1147085805 17:38060572-38060594 GTGCCCTGCTTCCCCAGCCCGGG - Intronic
1147095461 17:38135967-38135989 GTGCCCTGCTTCCCCAGCCCGGG + Intergenic
1147101752 17:38184538-38184560 GTGCCCTGCTTCCCCAGCCCGGG - Intergenic
1149846346 17:60011048-60011070 GTGCCCTGCTTCCCCAGCCCGGG - Intergenic
1150084696 17:62267623-62267645 GTGCCCTGCTTCCCCAGCCCGGG - Intergenic
1150330168 17:64287985-64288007 CTTCCCTGATTCCCTAGAACTGG + Intergenic
1150640465 17:66946305-66946327 GTCCCCTGCCTCCCCAGACCAGG + Intergenic
1151275448 17:73030625-73030647 GTTCCCTGCTCCCCTAGAAAGGG - Intronic
1153595435 18:6720524-6720546 GTACCCTGTTTCCTGAGAAGAGG + Intergenic
1156258507 18:35422621-35422643 GTATCCTGCTTCCCTGAAGCTGG - Intergenic
1161993391 19:7698212-7698234 GTCCCCGCCTTCCCTAGGACAGG + Intronic
1165061670 19:33207852-33207874 GTCCCCTGCTTCTCTGGAAATGG - Exonic
1166269109 19:41702861-41702883 GTGCCCTGCTTCCCCAGCCCTGG + Intronic
1167033038 19:46976349-46976371 GAACCCTGCTTATCTGGAACAGG - Intronic
930253339 2:49060723-49060745 GTACCTTGCTTCCCTGGAGCCGG + Intronic
930478199 2:51912257-51912279 GTAACCTGTTTCCATAGAAGAGG - Intergenic
931020144 2:58035071-58035093 GTACATTGCTTTCCTAGAAGAGG + Intronic
934458257 2:94193198-94193220 GAACCCTGCTTCCTTGGAACTGG + Intergenic
939576624 2:143902932-143902954 GTATCCTGCATGCCTAGAGCAGG - Intergenic
941059206 2:160826857-160826879 GTACCCTGCTTCCATAGTGCTGG - Intergenic
943475831 2:188354010-188354032 GTACCCTGCTTCCCTGGAGCTGG + Intronic
945991829 2:216402491-216402513 CTACCCTGCCTCCGTAAAACAGG - Intergenic
948205651 2:236161577-236161599 GAGCCCTGCTACCCTGGAACTGG + Intergenic
1172767213 20:37357167-37357189 GTCCCCTGCTCCCCAAGGACAGG - Intronic
1172924160 20:38515189-38515211 GCACACTGTTTCCATAGAACTGG - Intronic
1177106880 21:16967450-16967472 CTACTCTGCTTCCCTAGAACGGG + Intergenic
1177181190 21:17746226-17746248 CTACCCTTTTTCCCTGGAACAGG - Intergenic
1178526221 21:33331504-33331526 GTACCCCGCTTCCCTGGAGCTGG + Intronic
1181357951 22:22313229-22313251 GAACCCTGCTTCCTTGGAACTGG - Intergenic
1182959128 22:34455560-34455582 GTACCCTACATCCCTGGACCTGG + Intergenic
1184796507 22:46736430-46736452 GGCCCCTGCATCCCTAGGACGGG + Intronic
950137363 3:10591046-10591068 ATCCCCTGCTTGCCTACAACTGG + Intronic
950153374 3:10705585-10705607 CTACCATGCTTCCCTAGAAATGG - Intronic
951778911 3:26340927-26340949 GTGCCCTGCATCCCAAGAAATGG - Intergenic
954943218 3:54393831-54393853 GTACCCTGCTTCCCTAGAACTGG + Intronic
955622319 3:60877761-60877783 GTACCCTGCTTTCCTGAAGCTGG + Intronic
955667812 3:61368965-61368987 GTACAGAGCTTCCCTAGATCAGG - Intergenic
959449353 3:106480428-106480450 GTACCCTGCTTACCCAGATCTGG - Intergenic
963792075 3:149593719-149593741 TCCCCCTGCTTCCCTAGAATTGG - Intronic
972146775 4:36037640-36037662 TTATACTGTTTCCCTAGAACAGG + Intronic
978354903 4:107861570-107861592 GTACCCTCATTATCTAGAACTGG - Intronic
980152195 4:129061356-129061378 ATACCCTGCTTCCCTGGAGCTGG - Intronic
981918244 4:150058316-150058338 TTATCCTGCTTCCCTAGATGGGG + Intergenic
982350417 4:154409149-154409171 GTACCCTGTTTCCCTGGAAGTGG + Intronic
984590568 4:181613128-181613150 GGACCTTGTTTCCCTAGGACAGG + Intergenic
991050866 5:62271760-62271782 GTAGCCTGTTTCCCTAGCAAAGG + Intergenic
995212848 5:109560316-109560338 ATACCCTGCTTCCCAAGAACAGG - Intergenic
1002656687 5:180754068-180754090 GTACCCTGCTTCCCTGGAACTGG + Intergenic
1011319077 6:86069875-86069897 GTACCATTCTTCCCTAGAACTGG - Intergenic
1013723874 6:113067800-113067822 GTGCTCTGTTTCCCTAGACCAGG + Intergenic
1015082961 6:129250651-129250673 GTACCTTTCTTACCTAAAACAGG - Intronic
1015808203 6:137133520-137133542 GTACCTTGATTTCCTAGAACTGG + Intergenic
1020171883 7:5851373-5851395 GTTCACTGCATCCCTGGAACAGG + Intergenic
1021988005 7:26115816-26115838 GTACTCTGCTTCACTGGATCTGG + Intergenic
1024597141 7:50947634-50947656 GTACCCTACTTTCCTGGAGCTGG + Intergenic
1028360258 7:89958312-89958334 GTACACTGTTTCCCTAGGGCAGG - Intergenic
1031301872 7:120069955-120069977 GTACCCTGCTTGCCTGGAGCTGG + Intergenic
1037439741 8:18903520-18903542 GTATCCTGCTTCCGTGGAGCTGG - Intronic
1038478871 8:27887692-27887714 TTTCCCTGCTTCCCCAGAACTGG + Intronic
1040936524 8:52787649-52787671 TTCCCCTCCTTCCCTTGAACAGG - Intergenic
1041079387 8:54202186-54202208 GTATTCTGCTTCCCTGGAGCTGG - Intergenic
1041411701 8:57563401-57563423 GAATCCTGATTCCCCAGAACTGG - Intergenic
1042637518 8:70894673-70894695 GTACCCTGCATCCTAAGAAATGG - Intergenic
1044478103 8:92652048-92652070 GTTCCCAGCTTCACTAGGACTGG - Intergenic
1048577090 8:135701414-135701436 GCACCCTGCTTCCCTGGAGCTGG - Intergenic
1050406559 9:5314620-5314642 GTACCCTGCTTTCCTGGAACTGG + Intergenic
1053155486 9:35775413-35775435 GGCCCCAGCTTCCCTAGAACAGG - Intergenic
1053688766 9:40569003-40569025 GAACCCTGCTTCCTTGGAACTGG + Intergenic
1054275268 9:63062054-63062076 GAACCCTGCTTCCTTGGAACTGG - Intergenic
1054300006 9:63369914-63369936 GAACCCTGCTTCCTTGGAACTGG + Intergenic
1054399561 9:64702877-64702899 GAACCCTGCTTCCTTGGAACTGG + Intergenic
1054433144 9:65187142-65187164 GAACCCTGCTTCCTTGGAACTGG + Intergenic
1054497239 9:65834533-65834555 GAACCCTGCTTCCTTGGAACTGG - Intergenic
1058018299 9:100061961-100061983 CTGCCCTTCTTCCCTAAAACAGG + Intronic
1062227280 9:135460000-135460022 TTGCCCTGCATCCCTACAACCGG + Intergenic
1195523267 X:105855082-105855104 GTACCCTGCTTGCCTTTACCAGG + Intronic
1196187593 X:112761337-112761359 TCCCCCTGCTTCTCTAGAACTGG - Intergenic
1196406458 X:115367569-115367591 ATGCCCTGCTTCCCCAGATCTGG + Intergenic
1198414035 X:136401794-136401816 GTACCCTGCCCCCTTAGAATAGG - Intronic
1202579078 Y:26360200-26360222 TTAGCCTGCTTCCCAAGAAAAGG - Intergenic