ID: 954943245

View in Genome Browser
Species Human (GRCh38)
Location 3:54393986-54394008
Sequence GAAGCATCCTAGACCCTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 73}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954943245_954943247 -5 Left 954943245 3:54393986-54394008 CCATACAGGGTCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 954943247 3:54394004-54394026 GCTTCTGTGTCTCACCATCTGGG 0: 1
1: 0
2: 1
3: 21
4: 218
954943245_954943249 -3 Left 954943245 3:54393986-54394008 CCATACAGGGTCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 954943249 3:54394006-54394028 TTCTGTGTCTCACCATCTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 194
954943245_954943253 22 Left 954943245 3:54393986-54394008 CCATACAGGGTCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 91
954943245_954943246 -6 Left 954943245 3:54393986-54394008 CCATACAGGGTCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 954943246 3:54394003-54394025 TGCTTCTGTGTCTCACCATCTGG 0: 1
1: 0
2: 2
3: 22
4: 215
954943245_954943251 18 Left 954943245 3:54393986-54394008 CCATACAGGGTCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 954943251 3:54394027-54394049 GGTCCAGAGTTACCACTATGAGG 0: 1
1: 0
2: 5
3: 12
4: 82
954943245_954943248 -4 Left 954943245 3:54393986-54394008 CCATACAGGGTCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 954943248 3:54394005-54394027 CTTCTGTGTCTCACCATCTGGGG 0: 1
1: 0
2: 1
3: 33
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954943245 Original CRISPR GAAGCATCCTAGACCCTGTA TGG (reversed) Intronic
903572227 1:24314419-24314441 CAAGCTTCCTAGTCCCTGTCTGG - Intergenic
906369418 1:45240079-45240101 GAACCATTCTATTCCCTGTAAGG - Intronic
909793564 1:79703868-79703890 GAAGAATCCTTGAACCTGGAAGG - Intergenic
912011183 1:104965463-104965485 AAAGTATACTAGACCATGTAAGG + Intergenic
914838540 1:151228590-151228612 GAAGCATCCTGGATCCTTGAGGG + Intronic
915494553 1:156272470-156272492 TAAGCATCAGAGAACCTGTAGGG + Intronic
920362193 1:205426748-205426770 GAAGGATCCTGGAACCTGAAGGG - Intronic
924709909 1:246523245-246523267 GAAGCCCCCCACACCCTGTATGG - Intergenic
1065210317 10:23396371-23396393 CACGCATCCGAGACCCTGGAGGG + Intergenic
1068700044 10:60009930-60009952 GTAGCATCCTAGAGCGTGAAAGG + Intergenic
1073997540 10:109333068-109333090 GAAGCATTATAAACCCTGCAAGG + Intergenic
1074725778 10:116307511-116307533 GAAGCATCCTTAACCATGTTTGG - Intergenic
1077922617 11:6653102-6653124 GTGGCCTCCTAGACCCTGCATGG + Intronic
1078355555 11:10629333-10629355 GAAGGATCCTAGGCCCTCTGGGG - Intronic
1091719445 12:2801870-2801892 GGACCATCCAAGACCCTGAAGGG - Intronic
1101419354 12:104536996-104537018 GAAGCATTCTAGAAGCTGTTAGG + Intronic
1108936962 13:55893480-55893502 GAAGCATCTGAGACCTTTTATGG - Intergenic
1115789254 14:36860368-36860390 GAAGCCTCCAAGACCATGTAGGG + Intronic
1125450147 15:39799544-39799566 GAGGGAGCCCAGACCCTGTAGGG - Intronic
1131467528 15:92667688-92667710 GATGCATCCTAGACCCACTTTGG + Intronic
1131549110 15:93341541-93341563 GAAGCATCCTGTACCATGGAAGG - Intergenic
1136882856 16:33913541-33913563 CAAGCACCCTAGACACTTTAGGG - Intergenic
1138122730 16:54413522-54413544 GATGCATGCTGGATCCTGTAGGG - Intergenic
1138904002 16:61308213-61308235 GTAGCACCCTTGACCCTGTGGGG + Intergenic
1139939968 16:70598158-70598180 GAAGCATCTCAGACCCTTTAAGG - Intronic
1140546757 16:75817122-75817144 GGAGGACCCTAGACCCTGTAGGG + Intergenic
1141707613 16:85676571-85676593 GCAGCATGCTAGACACTGGAGGG + Exonic
1147185243 17:38709806-38709828 GAAGCCTCCTAGACTCTGACAGG - Intronic
1151805561 17:76402864-76402886 GATGCAGCCTAGAACTTGTAGGG - Intronic
1153809494 18:8739475-8739497 GAAGAATCCTAGGCAGTGTAGGG - Intronic
1158879125 18:61759800-61759822 GAAGCAACCTAGACACTGAAAGG + Intergenic
1161212605 19:3075403-3075425 ACAGCCTCCTAGACCCAGTAGGG + Intergenic
1161300475 19:3540181-3540203 GAAGAATCCTAGAACCTGGGAGG - Intronic
1161587515 19:5113646-5113668 GGAGCATCCTGGGCCCTGCAGGG + Intronic
1161949921 19:7462280-7462302 GACCCATCCGAGACCCTGCAGGG + Exonic
1162335704 19:10058959-10058981 GAAGCATCCCACACCCACTAGGG - Intergenic
1163073761 19:14869544-14869566 GAACCATCCAAGACCCTACATGG - Intergenic
1164780007 19:30884522-30884544 GAAGCTTCTGAGACCCTGTGAGG - Intergenic
1165971039 19:39629956-39629978 GAAGCAACCTCAACCCTGTCTGG - Intergenic
1166052328 19:40267735-40267757 GGTGCATCCTAGACCCCGGATGG + Intronic
925211891 2:2056447-2056469 GCAGCATCATATACCCTGCAAGG - Intronic
928174033 2:29022216-29022238 GATGGATCTTAGAGCCTGTAAGG + Exonic
929527213 2:42716031-42716053 GAAGCAACCCAAAGCCTGTAAGG - Intronic
929934748 2:46286481-46286503 GAGGGATCCTGGACCCTGGAAGG - Intergenic
932056619 2:68449485-68449507 GGAGCATCCTGGATCCTGGATGG - Intergenic
937338718 2:121077425-121077447 GATGCATCCCAGACTCTGGAAGG - Intergenic
944469901 2:200041786-200041808 GAAGCATCTTAGTGGCTGTAAGG - Intergenic
1169108306 20:3016250-3016272 GAACCAGCCTGGACCCTGTGAGG - Intronic
1171386789 20:24775005-24775027 AAAGCATAACAGACCCTGTAGGG + Intergenic
1173702357 20:45084233-45084255 GAAGCTTCCAAGACCATGGATGG + Intergenic
1175113068 20:56662677-56662699 GAAACATCACAAACCCTGTAAGG - Intergenic
1182801779 22:33037628-33037650 GAAGCATCCGAGACTCAGAAAGG + Intronic
949823933 3:8144548-8144570 AAAGCATCCTAAAACCTGTCAGG + Intergenic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
957402265 3:79731544-79731566 AAAACATCCTAGATGCTGTAAGG + Intronic
959239220 3:103767127-103767149 GACTCATCTTAGACCCTGTGCGG - Intergenic
966710503 3:182967706-182967728 GAAGAATCCTAGACACTTGAGGG - Intronic
976050456 4:81006118-81006140 GAACCATTCATGACCCTGTAGGG + Intergenic
985810291 5:2078205-2078227 GAGGCAGCCTAGGCCCTGCACGG - Intergenic
986482474 5:8202921-8202943 GAAGCAGCCAAGAGTCTGTAGGG - Intergenic
991138240 5:63208580-63208602 GAAGAATCCTAGAACCTGCAGGG + Intergenic
995188666 5:109298020-109298042 GAAGCATCATGAACCCTGCACGG - Intergenic
997161169 5:131610714-131610736 GAAGAATTATAGCCCCTGTATGG - Intronic
999069048 5:148724145-148724167 GAAGCATCCTAGGCCCGGTGAGG + Intergenic
1006022313 6:31124602-31124624 GAGGCTCCCTAAACCCTGTAAGG + Intronic
1011873991 6:91933435-91933457 AAAGCAGCCTATACCCTGAAAGG + Intergenic
1013502496 6:110766612-110766634 GCAGCATCATTGACCCTGCAGGG + Intronic
1017686571 6:156919549-156919571 GAAGCATCTCAGACACTGTTGGG + Intronic
1027502766 7:78974771-78974793 ACAGTATCCTAGACACTGTATGG + Intronic
1031444912 7:121841031-121841053 AAAGCATCCCAAATCCTGTAAGG - Intergenic
1038062965 8:23932432-23932454 CAAGCATCCTATACCCAGCATGG + Intergenic
1041392157 8:57356548-57356570 GAAGCTTCCTAGACTCTCTAAGG - Intergenic
1048402272 8:134083158-134083180 AAAACATACTAGACACTGTATGG - Intergenic
1053160262 9:35809192-35809214 GAAGCATCCTAGCTCATCTAGGG - Exonic
1056013892 9:82361725-82361747 GTAGTATTCTAGACCCTGTGAGG + Intergenic
1056210421 9:84360082-84360104 GAAGGAACCTTGAACCTGTAAGG + Intergenic
1057966884 9:99512960-99512982 GAAGCATCCTTGACCCCATAAGG + Intergenic
1059335015 9:113563633-113563655 GAAGGTTCCTAGGCCCTGCAAGG + Intronic
1060549744 9:124479300-124479322 GAAGCAGCCGAGACCCAGTGAGG + Intergenic
1062344036 9:136106713-136106735 GAAGGATGCTAGACCCTCTCTGG - Intergenic
1188844631 X:35058229-35058251 GAGGCATCCTAGCCCCTTTAAGG + Intergenic
1198618040 X:138480044-138480066 GAAGAGTCCCAGACCCTGTCAGG + Intergenic
1199567633 X:149232056-149232078 TAAGCATCCTACATCCTGCATGG - Intergenic