ID: 954943246

View in Genome Browser
Species Human (GRCh38)
Location 3:54394003-54394025
Sequence TGCTTCTGTGTCTCACCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954943241_954943246 15 Left 954943241 3:54393965-54393987 CCTTGTTGCTGCTGCATGTGTCC 0: 1
1: 0
2: 3
3: 8
4: 225
Right 954943246 3:54394003-54394025 TGCTTCTGTGTCTCACCATCTGG 0: 1
1: 0
2: 2
3: 22
4: 215
954943245_954943246 -6 Left 954943245 3:54393986-54394008 CCATACAGGGTCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 954943246 3:54394003-54394025 TGCTTCTGTGTCTCACCATCTGG 0: 1
1: 0
2: 2
3: 22
4: 215
954943240_954943246 27 Left 954943240 3:54393953-54393975 CCATTTTGGGTACCTTGTTGCTG 0: 1
1: 0
2: 1
3: 11
4: 171
Right 954943246 3:54394003-54394025 TGCTTCTGTGTCTCACCATCTGG 0: 1
1: 0
2: 2
3: 22
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954943246 Original CRISPR TGCTTCTGTGTCTCACCATC TGG Intronic
900900589 1:5513264-5513286 CGCTTGTGTGTCTCATCCTCAGG - Intergenic
901184481 1:7363926-7363948 TGGTTCTGTGACTCTCTATCAGG - Intronic
902407169 1:16191036-16191058 TACTTGTCTGTCTCACCATTAGG + Intergenic
902755961 1:18549350-18549372 TGCATCTGTGTTTCTCCAGCTGG - Intergenic
906376062 1:45297597-45297619 TGCTTCTGTGCCTCGGAATCAGG + Intronic
906459422 1:46025926-46025948 TGCTCCTGTGTGTGTCCATCTGG + Intronic
909041428 1:70657352-70657374 AGCTTATGTTTCTCACCAACTGG + Intergenic
909711920 1:78661174-78661196 TGCCTCTGTCTCTCAGCAGCTGG + Intronic
909816138 1:79996184-79996206 TGCACCTGTGGATCACCATCAGG + Intergenic
910095763 1:83519893-83519915 TGCTTCAGTTCCTCACCATGTGG + Intergenic
911237076 1:95423095-95423117 TGCCTCAGTGACTCAACATCTGG - Intergenic
911370592 1:96989993-96990015 TGCTTTTGTGTCTCTACAACTGG + Intergenic
913654499 1:120948152-120948174 TGCTCCAGTGTATAACCATCAGG - Intergenic
914520189 1:148408290-148408312 TGCTCCAGTGTGTAACCATCAGG - Intergenic
914644695 1:149642314-149642336 TGCTCCAGTGTATAACCATCAGG - Intergenic
915364381 1:155306196-155306218 GGCTTCTGTTTCTCACCCACAGG - Intergenic
917595104 1:176521378-176521400 TGCTAATGGGTCTCACCATGTGG - Intronic
919163675 1:193864416-193864438 TGGTTCTGTGGCTCAGCATTTGG + Intergenic
919290765 1:195627723-195627745 TGCTTCAGTGTTTCACAATGAGG - Intergenic
919486603 1:198155410-198155432 TTTTTCTATGACTCACCATCTGG + Intergenic
1062793423 10:323913-323935 TGCTTGTTTCTATCACCATCAGG + Intronic
1062923766 10:1299215-1299237 TGCTTGTGGGTTTCCCCATCTGG - Intronic
1065355349 10:24835103-24835125 TGCGGCTCTGTCTCACCAGCAGG + Intergenic
1065428695 10:25631766-25631788 AGCTTCTGTGCTTGACCATCTGG - Intergenic
1069859878 10:71463785-71463807 TCATTCTGTGTCTCTCCATCTGG + Intronic
1070495445 10:77017314-77017336 AGCTTTTGTGTCTCACAGTCTGG + Intronic
1070994150 10:80761328-80761350 TGCTGCTGTTTCTCACAATCAGG + Intergenic
1072307570 10:94122056-94122078 GGCTTCTGTGTGTCCCCAACAGG - Intronic
1073907136 10:108295668-108295690 TGCTTCTGTTTCTCCCCGTGGGG + Intergenic
1074743612 10:116508691-116508713 TGTTCCTGTGTCTTCCCATCTGG - Intergenic
1076382740 10:130036472-130036494 TGCTTCTGGGTCAAACAATCAGG - Intergenic
1077462071 11:2715645-2715667 TCCTTCTGTGTTTGACCACCTGG - Intronic
1077648579 11:3949103-3949125 TGCTTCTCTGTATCACAATTTGG - Intronic
1078559782 11:12361335-12361357 TCTTTCTGTATCTCAGCATCTGG - Intergenic
1083399892 11:62416131-62416153 TCCTTCTGTGTCCCATCATCTGG - Intronic
1084009445 11:66339411-66339433 TGCTTCTGTGCCCTACCATGGGG - Intronic
1084749864 11:71197519-71197541 TTCTTCTCTGTCTCTCCATCTGG + Intronic
1085255405 11:75169758-75169780 TGCTCCTGAGGCTCACCTTCTGG - Exonic
1085344308 11:75757811-75757833 TGAGTCTGTTTCTCAACATCAGG + Intergenic
1086578228 11:88364913-88364935 TGCTTCTGTTGTGCACCATCAGG + Intergenic
1087313609 11:96579308-96579330 TGATTATGTGTCTCCCCCTCTGG + Intergenic
1088727385 11:112651613-112651635 TGCTTCTCTGTCTCACAAAGAGG + Intergenic
1088904401 11:114143334-114143356 TGTTTCTCTGTCTCTCCAGCTGG - Intronic
1089324574 11:117648293-117648315 TGCTCCTGGGTCTCCCCAGCAGG + Intronic
1089342167 11:117765386-117765408 TGCCTCTCTGTCCCACCATGAGG + Intronic
1091196431 11:133734899-133734921 TCCTTCTGTGTCTAACCAACTGG + Intergenic
1091963948 12:4722362-4722384 TGCTTCTCTCTCTCAGCCTCAGG + Intronic
1095292691 12:40493490-40493512 CTCTTCTGTCTCTCACCTTCTGG - Intronic
1096455955 12:51786591-51786613 TGCTGGTGTGTCTCATCTTCTGG + Exonic
1096616610 12:52836634-52836656 TGCTTTTGTGTCCTGCCATCAGG - Intergenic
1098874198 12:75849967-75849989 TACGTCTGTGTCTAATCATCTGG - Intergenic
1099887807 12:88553354-88553376 TGCTTCAGTGTATCTCCATTAGG - Intronic
1101753248 12:107600752-107600774 TTCATCTGGGTCTCACCAGCAGG - Intronic
1102270348 12:111529294-111529316 TGCTTTTGTTTCTCACCATAGGG - Intronic
1102556151 12:113728004-113728026 AGCTTGTGTGCCTCACCATTAGG + Intergenic
1104581616 12:130015097-130015119 TGCTTCTCTGTCTCCACATATGG + Intergenic
1104588029 12:130063059-130063081 TGATTCCGTGTCTCACATTCAGG - Intergenic
1105872483 13:24517761-24517783 TGCTTCTGGCTCTGATCATCAGG - Intergenic
1105907108 13:24822801-24822823 AGTTTCTGTGTCACAGCATCAGG - Intronic
1105915318 13:24910050-24910072 TGCTTCTGGCTCTGATCATCAGG + Exonic
1107053734 13:36080272-36080294 TGCCTCTTTGTCTCACCTTTCGG - Intronic
1108936053 13:55880883-55880905 TGCTTTTTTGTCTGTCCATCTGG + Intergenic
1109198175 13:59402246-59402268 TGATTCTGTGTATTACCAACTGG + Intergenic
1109220332 13:59635126-59635148 TGCTTCTGTGTGGCACAATTGGG - Intergenic
1109832634 13:67812245-67812267 TGATTCTTTGTCTCACATTCAGG + Intergenic
1109979909 13:69894306-69894328 TGCTTCTTAGTCTTTCCATCAGG + Intronic
1110608682 13:77464076-77464098 TGCTTCTGTGTGTCACCACCAGG - Intergenic
1110805357 13:79748007-79748029 TGCTTCTGTGTCTCAGAAGGTGG - Intergenic
1114457639 14:22866960-22866982 TGCATCTGCCTCTCACCTTCAGG + Intergenic
1115724667 14:36200022-36200044 TGATTCTGTGACACACCATGTGG + Intergenic
1116201329 14:41801660-41801682 TGCTTCAGTGCCCCAACATCTGG - Intronic
1118735813 14:68701244-68701266 TGCTTTTGTCTAGCACCATCAGG + Intronic
1119143033 14:72284886-72284908 TGACTCTGTGTCTCACATTCAGG - Intronic
1120118158 14:80644124-80644146 TGCTTCTTTGTCTCAGCTTTTGG - Intronic
1124721092 15:32111217-32111239 TGACTCTGCGTTTCACCATCAGG + Intronic
1125521647 15:40351180-40351202 TGCTTCCGTGTCTCTGCATGAGG + Intronic
1126312075 15:47328755-47328777 TGCTTCTGTGACTCACGAAAAGG + Intronic
1131065815 15:89434398-89434420 TCCTGCTGAGTCTCCCCATCAGG - Intergenic
1131155942 15:90075548-90075570 TGCCTCTGAGTCACACCAGCTGG + Intronic
1131199603 15:90385868-90385890 TGGTCCTGTTCCTCACCATCGGG + Intergenic
1131809693 15:96160060-96160082 TGCTTCTATTCCCCACCATCAGG + Intergenic
1131906198 15:97145688-97145710 AGCTTCTGTGTCACACCACAAGG - Intergenic
1132633700 16:932285-932307 TGCTGCCGTGTCTCAGCACCAGG - Intronic
1133840130 16:9400470-9400492 TGCTTCTGTGTTTCAGAAACAGG - Intergenic
1134301359 16:12994255-12994277 TGCTTCCGTGGCTCACACTCTGG - Intronic
1134569538 16:15279540-15279562 TGCTCCTTTGTCTCCCCAGCAGG + Intergenic
1134732841 16:16476509-16476531 TGCTCCTTTGTCTCCCCAGCAGG - Intergenic
1134934601 16:18235462-18235484 TGCTCCTTTGTCTCCCCAGCAGG + Intergenic
1135835801 16:25824146-25824168 TGTTTCTGTGTCTTCCCTTCAGG - Intronic
1136613411 16:31380767-31380789 TGCTGCTGTGTCTCACCTCTTGG + Intronic
1138022805 16:53500158-53500180 TGCTTCTGTGTCTGAAAATAGGG - Intronic
1140848797 16:78914944-78914966 TGATTCTCTGTCTCTCCACCAGG - Intronic
1144050532 17:11494090-11494112 GGCTTCTGTGTCTTCCCAGCAGG + Intronic
1146942520 17:36853694-36853716 TCCTTCTGTGTGTCAGCCTCTGG + Intergenic
1148178398 17:45586253-45586275 TGCTTCTGTGCCGCAGCACCGGG + Intergenic
1149101287 17:52909657-52909679 TGACTCTGTGTCTCACATTCAGG - Intergenic
1149237490 17:54609943-54609965 TGCTTCAGTTTCTCACCAGGTGG + Intergenic
1149650669 17:58274439-58274461 TGGTTCTGTCTCTCAACATCTGG - Intronic
1151509451 17:74549397-74549419 TGCTACTGGTTCTCACCCTCTGG + Intergenic
1157148069 18:45186654-45186676 TGCTTCTGTCTCTCCAGATCTGG - Intergenic
1157396731 18:47347770-47347792 TGCTTCTGTTGCTCATCTTCTGG - Intergenic
1158818133 18:61127549-61127571 TGCATTTGTGTCTCACACTCTGG + Intergenic
1160733351 19:651057-651079 TGGTTGTGTGTCTCACCTGCTGG - Intronic
1163430347 19:17263560-17263582 AACTTCTGTCTCTCACCTTCAGG - Intronic
1163734686 19:18972457-18972479 TGCTTCTTTGTTTCTCCATCAGG + Intergenic
1164420562 19:28088183-28088205 TGCTTCTGTGGCTCCACCTCTGG + Intergenic
1166906224 19:46110323-46110345 TGCTCCTGTATTTCACCCTCAGG + Intergenic
1167759536 19:51436814-51436836 TCCCTATGTGTCTCACCATGGGG - Intergenic
1168363845 19:55767455-55767477 TGCTTCTGTGACACACCTGCAGG + Intergenic
928097829 2:28415484-28415506 TGCTTCTGTTTCTCAGGCTCTGG + Exonic
929528178 2:42725802-42725824 TGGCTCTGTGTCACACCAGCAGG - Intronic
929981202 2:46681936-46681958 TGGCTCTGTGTCTCAGCCTCAGG - Intergenic
931261378 2:60622530-60622552 TGATTTTGTGTCTCACCTCCTGG + Intergenic
931297773 2:60946337-60946359 TACTTCTGTGTATAACCATGTGG + Intronic
932034956 2:68235008-68235030 TCCCTCTGTGTTCCACCATCAGG - Intronic
932475923 2:72005826-72005848 TGCTTCTGTCTCTCAGTCTCTGG - Intergenic
932656469 2:73615044-73615066 TCCCTCTCAGTCTCACCATCAGG + Intergenic
933187728 2:79297346-79297368 AACTTCAGTGTCTGACCATCTGG + Intronic
934744488 2:96750146-96750168 GGCTTCAGTTTCTCACCATGAGG - Intergenic
938711611 2:133980135-133980157 TGCTTCTTCATCTCACCATCAGG - Intergenic
938736049 2:134187605-134187627 TCCTTCTTTGTCTCTCCTTCTGG + Intronic
940256137 2:151731592-151731614 AGCATCTGTGTCTGACCAGCAGG - Intronic
940918392 2:159282873-159282895 TGCTGCTGTTTCTCCCCTTCAGG - Exonic
941489440 2:166125422-166125444 TGCTTTTGTGTGTCACTGTCAGG + Intronic
941919930 2:170840293-170840315 TATTTCTGTCTCTCATCATCTGG + Intronic
942664711 2:178304976-178304998 TGATTCAGTGTCTCACCCTCTGG + Intronic
944134184 2:196380316-196380338 TTCTTCTGTGCCTGACCTTCAGG - Intronic
945045254 2:205776224-205776246 CTCTTCTGTGTCTCTCCACCAGG + Intronic
945414141 2:209549878-209549900 AGCTTCTCTTTCTCACCCTCTGG + Intronic
947040940 2:225918757-225918779 TGCTTCTCTGTCTCTCCTGCAGG + Intergenic
947331770 2:229036312-229036334 GGCTTCTGTGTGTCATCCTCAGG + Intronic
948001764 2:234573597-234573619 TGCTCCTGTGTCTCACCACGAGG - Intergenic
1169947346 20:11003328-11003350 TCCTTCTGTGTCTCAAAATCAGG + Intergenic
1170518825 20:17161763-17161785 TGCATGTGTGTCTCACCATGTGG - Intergenic
1171162665 20:22942042-22942064 TGCTTCTGTGTCTCTAGCTCAGG - Intergenic
1173895426 20:46547113-46547135 TGCTTTTGTGTCTGAGCAACTGG + Intronic
1175234764 20:57502203-57502225 TTTCTCTGCGTCTCACCATCTGG - Intronic
1177312358 21:19413580-19413602 TGCTGCTATGTCTCACATTCAGG - Intergenic
1178208130 21:30494223-30494245 TTCTTCTGTGTGTCACTATTAGG + Intergenic
1179308010 21:40172513-40172535 TGCTTCTGTCCCTCCCCAGCTGG + Intronic
1180171827 21:46063427-46063449 TGTTTCTGTGTCTCACTTCCGGG - Intergenic
1184334205 22:43843892-43843914 TGCCTGTGTGTCTCACCCACTGG - Intronic
1184842878 22:47062955-47062977 CGCTGCTGTTTCTCACCTTCAGG - Intronic
950316115 3:12003758-12003780 TTCTTTTTTGTCTCACCATAGGG + Intergenic
950542262 3:13619625-13619647 TGTTTCTGTGTCTCACTAGTAGG + Intronic
950563184 3:13747818-13747840 TGCATCTGTGTGTCTGCATCTGG - Intergenic
954943246 3:54394003-54394025 TGCTTCTGTGTCTCACCATCTGG + Intronic
955468533 3:59261879-59261901 TGCTTCTGTGGCTTTCCATCAGG + Intergenic
958768227 3:98396086-98396108 TTCTTCTGGGTCTAACCACCCGG - Intergenic
958986101 3:100781520-100781542 TCCTCCTGTGTCTCACTGTCAGG + Intronic
959777709 3:110188408-110188430 TGTCTCTGTGTCTCACAACCAGG + Intergenic
960519442 3:118638114-118638136 TTCTTCTGTGACTCATCATCTGG - Intergenic
961650869 3:128416127-128416149 TGCTTGTCTGTCTTATCATCGGG - Intergenic
962210098 3:133470748-133470770 TCCTTCCAAGTCTCACCATCTGG + Intronic
964060607 3:152517864-152517886 GGCTTCTGTGTGTCACTAGCTGG - Intergenic
964409590 3:156383914-156383936 TGCTACAGTCTGTCACCATCAGG + Intronic
965376199 3:167927202-167927224 TGTTTCTGTTTCTCTACATCAGG + Intergenic
966910985 3:184559900-184559922 TGCCTCTGTCTCTGACCAGCAGG + Intronic
969437766 4:7198636-7198658 TGCTTCTGTCTCTCTCCAGGTGG - Intronic
970751148 4:19363552-19363574 TGTTTATGAGTCTCAACATCAGG + Intergenic
971176275 4:24285354-24285376 TGCTTGTGTATCTCACCATGTGG - Intergenic
971258969 4:25039018-25039040 TGCTCCTGTGTGTCAGCATTTGG - Intergenic
971265587 4:25093806-25093828 GGCTTCTGGGCCTCTCCATCTGG + Intergenic
972010366 4:34172160-34172182 TGCCTCTGTGTCTACACATCAGG - Intergenic
974319979 4:60334437-60334459 TGATTCTATGTCTCACATTCAGG - Intergenic
977365400 4:96061750-96061772 TTCTTCTTTGTGTCAACATCCGG + Intergenic
978770117 4:112447209-112447231 GGCTTCTGTTCCTCACCATGTGG + Intergenic
979567977 4:122178351-122178373 TGCTTCTGCAGCTCACCAACTGG - Intronic
981394556 4:144232647-144232669 TGTTTCTGAGTCTCACCTTTGGG - Intergenic
981437104 4:144737344-144737366 AGCCTCTGTGTCTCCCCCTCAGG + Intronic
984304418 4:177969280-177969302 TGCTTCTCAGTATTACCATCTGG - Intronic
985543584 5:498266-498288 TGCTTCCGTGACTCACATTCCGG + Intronic
986130407 5:4924616-4924638 TGCTGCTGTGGATCACCACCTGG - Intergenic
986508189 5:8474409-8474431 TTGTTCTGTTCCTCACCATCAGG - Intergenic
988130755 5:27101636-27101658 TGTTTCTATTTCTCAACATCAGG + Intronic
988300128 5:29413229-29413251 TCTTTCTGTGTTTCACCATCAGG + Intergenic
988693818 5:33598928-33598950 TGCATCTGTGTCTCAATCTCGGG + Intronic
996399043 5:123039917-123039939 AGCTTCAGTGTTTCACCATTAGG + Intergenic
997372214 5:133369363-133369385 TGCTCCTGTGTCTCCTCAGCAGG + Intronic
998820570 5:146054049-146054071 TGCTTTTCAGTCTCTCCATCTGG + Intronic
999645545 5:153713485-153713507 TGGTTCTGGGTCTCACCATCAGG - Intronic
1000037063 5:157456884-157456906 TGCATCTGTCTCTCAGGATCTGG + Intronic
1002445091 5:179285822-179285844 AGCTTCCATGTCTCACCAGCTGG + Intronic
1003094733 6:3133329-3133351 TGATTCTGTGCCTCTCCAACCGG + Intronic
1005178346 6:23074007-23074029 TCATTCTGTGTCTCAACATGTGG - Intergenic
1007076978 6:39074385-39074407 TGCTTCTGCCTCTCACCACGTGG + Intronic
1007926138 6:45651253-45651275 TGCCACTGTGTCTCTCCCTCAGG - Intronic
1007935612 6:45729563-45729585 TGGGTCTCTGTCTCACCATCAGG + Intergenic
1010080129 6:71852007-71852029 TTCTGATGTGTCTCACTATCTGG + Intergenic
1010982541 6:82385317-82385339 TGCATCTGGCTCTCACCCTCAGG - Intergenic
1011158136 6:84356516-84356538 TCCTTCCATGTCTCTCCATCTGG + Intergenic
1011726191 6:90212825-90212847 GGCCTCTGTTTCTCCCCATCTGG - Intronic
1012932392 6:105330575-105330597 TGCTGCGGTGTCTCTCCCTCTGG - Intronic
1013261748 6:108451025-108451047 TGTTTCTGTTTATTACCATCTGG + Intronic
1014723305 6:124945818-124945840 TGCTTCTGTGTTTCAGGGTCAGG + Intergenic
1015986717 6:138892028-138892050 TTCTTCTGTCTCTCTTCATCTGG + Intronic
1016979073 6:149837711-149837733 TGCTTCTGTGTGCCACCTCCTGG - Intronic
1017821306 6:158050835-158050857 TGCTTCTGGGTCTTTCCATGGGG + Intronic
1018702118 6:166435646-166435668 TGCTGCTGTTTCTCACCACAGGG + Intronic
1020504443 7:8966182-8966204 AGCTTCTGTTTCACTCCATCTGG - Intergenic
1020754993 7:12190844-12190866 TGATTCTGTGTCTCACATCCAGG + Intergenic
1020921015 7:14264398-14264420 TGCCTATGTGTGTCACAATCAGG - Intronic
1020936066 7:14465464-14465486 TGCCTCCAAGTCTCACCATCTGG - Intronic
1021389560 7:20074871-20074893 TTCTTTTGTGCCTCAGCATCAGG - Intergenic
1022345246 7:29508486-29508508 TGCCTTTGTGTCTCCCCATCAGG - Intronic
1023521341 7:41052970-41052992 TGCTGATGTGGCTCACCATCAGG - Intergenic
1026865713 7:73822851-73822873 TGCTTCTGTGACACACCAAGAGG - Intronic
1027371928 7:77515363-77515385 GGCTTCAGTTTCTCACCATGTGG + Intergenic
1028984906 7:97002125-97002147 TGCTTCTTTGTCTCGCCCGCAGG - Intergenic
1030102495 7:105958536-105958558 TACTTCTGTGTCTCATCTTAAGG + Intronic
1031578283 7:123441835-123441857 TCCTTCTTTGTCTCAGCTTCTGG - Intergenic
1032856053 7:135834457-135834479 TGCTTCTGTGTTTGACAATGTGG - Intergenic
1035623146 8:1050317-1050339 TGCTTCTGTTTTTCACTTTCAGG + Intergenic
1040693652 8:49970163-49970185 TATCTCTGTATCTCACCATCTGG + Intronic
1040878055 8:52173704-52173726 TGTTTCTGTGTCTCAAAAGCAGG + Intronic
1044884871 8:96766424-96766446 TGCTTCTGTGACACTTCATCAGG + Intronic
1045207489 8:100057073-100057095 TGATTCTATGTCTCACCTCCAGG - Intronic
1045324477 8:101108087-101108109 TGTTTCAGTTTGTCACCATCTGG - Intergenic
1046358305 8:113117011-113117033 TTCTTTTCTGTCACACCATCAGG - Intronic
1047409996 8:124616553-124616575 TGCTTATGTGTCTCACTCTCTGG - Intronic
1047793171 8:128226265-128226287 TGCTTCTGTCACTCATCATCTGG - Intergenic
1048850510 8:138641014-138641036 TTCTTCTCTGTCACAGCATCAGG + Intronic
1048903197 8:139060194-139060216 GGCCTCTGTGTCTCAGCCTCAGG + Intergenic
1051486018 9:17609016-17609038 TGCTTCTGTGTCACACCGCTGGG + Intronic
1052825049 9:33167943-33167965 CACTTCTGTGCCTCCCCATCAGG + Intergenic
1053302357 9:36961012-36961034 TGGATCTGTGTCCCACCATGAGG - Intronic
1053305669 9:36982770-36982792 TGCTTCTGTGTCTCCGGGTCAGG + Intronic
1056067785 9:82954903-82954925 TGCTGCTGTGTTTCTTCATCTGG + Intergenic
1057140170 9:92721942-92721964 ATCCTCTGAGTCTCACCATCAGG - Intronic
1058804942 9:108581725-108581747 TTCATCTGTGTCACACCATGAGG - Intergenic
1060315963 9:122510839-122510861 TCCTTCTGGGCCTCCCCATCCGG + Exonic
1060537084 9:124399265-124399287 AGCTTCTGTGCCTCACTCTCAGG - Intronic
1061407573 9:130400926-130400948 GGCTATCGTGTCTCACCATCGGG + Intronic
1062275029 9:135726430-135726452 GGCTTCTGTGGCTCGCCATGTGG + Intronic
1185874934 X:3694440-3694462 TGTGTCTGTGTCTCCTCATCTGG - Intronic
1187574830 X:20542857-20542879 TGATTCTGTGTCTCACATCCAGG - Intergenic
1187634463 X:21211534-21211556 TGACTCTGTGTCTCACATTCAGG - Intergenic
1194542961 X:95197527-95197549 TTCTTGTGTGTCTCTTCATCTGG + Intergenic
1199375045 X:147098193-147098215 TCCTTCTGTCTCTCTCTATCTGG - Intergenic
1199557384 X:149123867-149123889 TACTTCTGTGTCTCTCTATAAGG + Intergenic