ID: 954943247

View in Genome Browser
Species Human (GRCh38)
Location 3:54394004-54394026
Sequence GCTTCTGTGTCTCACCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954943240_954943247 28 Left 954943240 3:54393953-54393975 CCATTTTGGGTACCTTGTTGCTG 0: 1
1: 0
2: 1
3: 11
4: 171
Right 954943247 3:54394004-54394026 GCTTCTGTGTCTCACCATCTGGG 0: 1
1: 0
2: 1
3: 21
4: 218
954943241_954943247 16 Left 954943241 3:54393965-54393987 CCTTGTTGCTGCTGCATGTGTCC 0: 1
1: 0
2: 3
3: 8
4: 225
Right 954943247 3:54394004-54394026 GCTTCTGTGTCTCACCATCTGGG 0: 1
1: 0
2: 1
3: 21
4: 218
954943245_954943247 -5 Left 954943245 3:54393986-54394008 CCATACAGGGTCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 954943247 3:54394004-54394026 GCTTCTGTGTCTCACCATCTGGG 0: 1
1: 0
2: 1
3: 21
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954943247 Original CRISPR GCTTCTGTGTCTCACCATCT GGG Intronic
900821898 1:4896193-4896215 GAGTCTGGGTTTCACCATCTTGG - Intergenic
900900588 1:5513263-5513285 GCTTGTGTGTCTCATCCTCAGGG - Intergenic
902755960 1:18549349-18549371 GCATCTGTGTTTCTCCAGCTGGG - Intergenic
904147206 1:28402636-28402658 GGTGCTGTGGCTCACCATATAGG + Intronic
906459423 1:46025927-46025949 GCTCCTGTGTGTGTCCATCTGGG + Intronic
907632477 1:56096405-56096427 GCCTCAGTTTCTCACCATGTGGG + Intergenic
909711921 1:78661175-78661197 GCCTCTGTCTCTCAGCAGCTGGG + Intronic
910095764 1:83519894-83519916 GCTTCAGTTCCTCACCATGTGGG + Intergenic
910160552 1:84267679-84267701 GCTTCAGTGCCTCACCACATGGG - Intergenic
911229623 1:95347303-95347325 CCTTCTGTGGCTTCCCATCTAGG + Intergenic
911370593 1:96989994-96990016 GCTTTTGTGTCTCTACAACTGGG + Intergenic
912551842 1:110489907-110489929 GCCTCTGTGTCTCCCCATCTAGG - Intergenic
912639923 1:111335258-111335280 TCTTCTGTGTCTCTCACTCTGGG - Intergenic
913555126 1:119958535-119958557 GCTTCTGTGTGTCACTGTCCAGG + Intronic
916352574 1:163868124-163868146 TCTTCTGTGTTTGACCATCTTGG + Intergenic
916611627 1:166397414-166397436 GCTTGTTTATCTCACCATCTTGG - Intergenic
918082710 1:181220106-181220128 TCTTCTGTGACTCACCACCCTGG + Intergenic
918398162 1:184136688-184136710 TCTTCTGTGTCTCTCAAGCTGGG + Intergenic
919598498 1:199593672-199593694 TCTTCTGTGTCTAGCCATCCAGG - Intergenic
919911719 1:202115215-202115237 GGTCCTGTGTCTCCCTATCTTGG - Intergenic
921632943 1:217456306-217456328 GCTCCTGTATCTGTCCATCTGGG + Intronic
921710406 1:218367987-218368009 GCGACAGGGTCTCACCATCTTGG + Intronic
921809286 1:219493513-219493535 ATTTCTGTGTTTCACCATCTTGG + Intergenic
923049573 1:230381424-230381446 ACTTCTCAGTCTCAGCATCTTGG + Intronic
923331676 1:232931123-232931145 TCCTCTGTGTCTAACCATCAAGG - Intergenic
924896924 1:248349101-248349123 GCTTCTGTTTCTCACCATTATGG + Exonic
1062923765 10:1299214-1299236 GCTTGTGGGTTTCCCCATCTGGG - Intronic
1063171575 10:3514535-3514557 GAATCTGTGGCTCACAATCTGGG - Intergenic
1066424057 10:35289685-35289707 GAGTCTGGGTCTCACCATGTTGG - Intronic
1067458354 10:46439574-46439596 GCTTCTATGTCACTCCCTCTGGG - Intergenic
1067628844 10:47945060-47945082 GCTTCTATGTCACTCCCTCTGGG + Intergenic
1069146846 10:64903278-64903300 TTTTCGGGGTCTCACCATCTTGG - Intergenic
1069859879 10:71463786-71463808 CATTCTGTGTCTCTCCATCTGGG + Intronic
1071257532 10:83885377-83885399 GCTTCAGTGTCTGAGTATCTGGG - Intergenic
1073381005 10:103078090-103078112 GCATCTGTGTAGCAGCATCTTGG - Exonic
1073467083 10:103700568-103700590 GCTGCTCAGTGTCACCATCTAGG - Intronic
1073907239 10:108296518-108296540 GCTTCTTTTTCTCACAATCCTGG - Intergenic
1075449557 10:122540338-122540360 GCTTCTTTGTCTTATCTTCTTGG - Intergenic
1077105589 11:841083-841105 GCTTCTGTGTCTCTGCACATTGG - Intronic
1077462069 11:2715644-2715666 CCTTCTGTGTTTGACCACCTGGG - Intronic
1078399160 11:11009080-11009102 GCTGCTATGTCTCACCGTGTGGG + Intergenic
1078881933 11:15459987-15460009 GATTCTTTGTCTCCACATCTTGG + Intergenic
1083399890 11:62416130-62416152 CCTTCTGTGTCCCATCATCTGGG - Intronic
1084450456 11:69233695-69233717 GTTTCAGTGTATCAGCATCTGGG - Intergenic
1084749865 11:71197520-71197542 TCTTCTCTGTCTCTCCATCTGGG + Intronic
1084780475 11:71404985-71405007 GATCTTGTGTTTCACCATCTAGG + Intergenic
1086194221 11:84117586-84117608 GCTTGTGTGACTCACCAGTTGGG + Intronic
1087448647 11:98288675-98288697 GCTTCTCTGTCTTACCAGCCAGG + Intergenic
1087568144 11:99889723-99889745 GATACTGGGTTTCACCATCTTGG + Intronic
1088717150 11:112558915-112558937 GCTTCGGTTCCTCACCATATGGG + Intergenic
1089337691 11:117736307-117736329 GCTTCAGTTCCTCACCATGTGGG + Intronic
1089808524 11:121113261-121113283 GCTTCTGTGGCTCAGCATCCTGG + Intronic
1091580184 12:1781817-1781839 ACTTCTGTGTCTAACCTTCCAGG - Intronic
1092043909 12:5411388-5411410 GCTTTTGTGTTTCAACATATTGG + Intergenic
1093410414 12:18858527-18858549 GCTTGTGTGTCTTACATTCTAGG - Intergenic
1096511029 12:52128645-52128667 GATACTGGGTCTCACCATGTTGG - Intergenic
1097329402 12:58317190-58317212 GCTTCAGTTCCTCACCATGTGGG + Intergenic
1098237861 12:68435180-68435202 GCTTCAGTTTGTCACCATGTGGG - Intergenic
1098291330 12:68959304-68959326 ACTTCTGAGTCTCATCATTTAGG - Intronic
1100433740 12:94552924-94552946 TCTTCTGTGTTTTAGCATCTTGG + Intergenic
1102270347 12:111529293-111529315 GCTTTTGTTTCTCACCATAGGGG - Intronic
1104420358 12:128629777-128629799 GAGACTGAGTCTCACCATCTTGG - Intronic
1104581617 12:130015098-130015120 GCTTCTCTGTCTCCACATATGGG + Intergenic
1105907107 13:24822800-24822822 GTTTCTGTGTCACAGCATCAGGG - Intronic
1108936054 13:55880884-55880906 GCTTTTTTGTCTGTCCATCTGGG + Intergenic
1113317337 13:109196157-109196179 TCTTGTGTCTCTCAACATCTAGG - Intronic
1113537600 13:111080696-111080718 GCTTCTTGGTATCACCATATTGG - Intergenic
1114337523 14:21707258-21707280 GCTGCTGTTTCTCACCATTATGG + Intergenic
1115696107 14:35900424-35900446 GAGTCTGGGTTTCACCATCTTGG + Intronic
1116201328 14:41801659-41801681 GCTTCAGTGCCCCAACATCTGGG - Intronic
1122050822 14:99058524-99058546 GCTTTGGGGTCCCACCATCTTGG - Intergenic
1122446009 14:101769175-101769197 GAAGCTGTTTCTCACCATCTTGG + Intronic
1122816218 14:104315472-104315494 GCTTTGGGGTCTCAGCATCTTGG - Intergenic
1122940090 14:104977333-104977355 GCCTGGGTGTCTCAGCATCTTGG - Intronic
1123024622 14:105418984-105419006 CCATCTGTTTCTCTCCATCTGGG + Intronic
1123907971 15:24939072-24939094 GCTTCTGTGTTTGACTATTTGGG - Intronic
1124421822 15:29529499-29529521 TCTTCTGGCTCTCACCTTCTAGG - Intronic
1125256338 15:37768299-37768321 GCTTCTGTCTCTCTCTCTCTCGG - Intergenic
1126770613 15:52052270-52052292 GCTTCGGTTCCTCACCATGTGGG + Intronic
1126946529 15:53827790-53827812 GATTCAGTGTTTCACCATGTTGG - Intergenic
1127388588 15:58487200-58487222 GCAGCTGGGACTCACCATCTGGG - Intronic
1127608028 15:60609648-60609670 TCTTCTGTGTCTTCCCATTTTGG - Intronic
1129937137 15:79460195-79460217 GCTTGTGACTCTCACCACCTTGG + Intronic
1130612709 15:85376125-85376147 GCTTATCTGTCTCATCCTCTTGG + Intergenic
1130788114 15:87122839-87122861 ACTGCTGTGTCCCAGCATCTAGG + Intergenic
1131155943 15:90075549-90075571 GCCTCTGAGTCACACCAGCTGGG + Intronic
1131835012 15:96381630-96381652 ACTTCAGTTTCTCACCATGTGGG - Intergenic
1133555045 16:6897928-6897950 CCCTCTGTGTCTCACCAGGTCGG + Intronic
1134322018 16:13172526-13172548 TCCTCTCTGTGTCACCATCTAGG + Intronic
1134759511 16:16701629-16701651 GCTTCTGTTTCTCCCCTTCTTGG + Intergenic
1134841646 16:17406433-17406455 GTTCCTGTGAATCACCATCTGGG + Intronic
1134986559 16:18657565-18657587 GCTTCTGTTTCTCCCCTTCTTGG - Intergenic
1136004928 16:27322976-27322998 GCTTCTGTGTCTCAGATGCTTGG + Intronic
1136473078 16:30494757-30494779 GCAGCTCTGTCTCCCCATCTTGG - Exonic
1138803645 16:60065999-60066021 GCTTCTGTTCCTCACCACATAGG + Intergenic
1140643186 16:77001378-77001400 GCTTCTGTGTATCTTCCTCTAGG + Intergenic
1142276500 16:89121701-89121723 CCTTCTCTGTGACACCATCTTGG + Intronic
1143192880 17:5053304-5053326 GCTTCTGTGTCTCTGGCTCTTGG - Intergenic
1146942522 17:36853695-36853717 CCTTCTGTGTGTCAGCCTCTGGG + Intergenic
1148641891 17:49193908-49193930 GCTTCTTTGGATCAGCATCTCGG + Intergenic
1149237491 17:54609944-54609966 GCTTCAGTTTCTCACCAGGTGGG + Intergenic
1154089046 18:11339938-11339960 CCTTCTGTGTTTCAACATTTTGG - Intergenic
1155141082 18:23044949-23044971 TCTTCTGGGTGTCACCTTCTGGG + Intergenic
1157148068 18:45186653-45186675 GCTTCTGTCTCTCCAGATCTGGG - Intergenic
1157396730 18:47347769-47347791 GCTTCTGTTGCTCATCTTCTGGG - Intergenic
1157521098 18:48346110-48346132 GCTTCTCTTCCTCACCATGTTGG + Intronic
1157756801 18:50225858-50225880 GCTTCAATGTCTCCCCATATGGG + Intergenic
1158594904 18:58807461-58807483 TCTTCTGTTTCTCACTTTCTGGG - Intergenic
1159915146 18:74182111-74182133 CCTTCTGTCTCTCACTTTCTCGG + Intergenic
1161474694 19:4477891-4477913 GATACTGGGTTTCACCATCTTGG - Intronic
1162843242 19:13371772-13371794 GCTTCTTTCTTTCAGCATCTTGG - Exonic
1163177613 19:15575557-15575579 GCTTCTGTCCCTCACAAGCTTGG + Intergenic
1164420563 19:28088184-28088206 GCTTCTGTGGCTCCACCTCTGGG + Intergenic
1164534233 19:29073156-29073178 GCTGGTGGGTCTCACCATCATGG - Intergenic
1165264474 19:34648159-34648181 GTTTCTGTGTCTCATCCTCCTGG - Intronic
1166058272 19:40307279-40307301 GACTCTGTGTTTCACCATGTTGG + Intergenic
1168678461 19:58296227-58296249 AGTTCTGTTCCTCACCATCTTGG + Exonic
928097830 2:28415485-28415507 GCTTCTGTTTCTCAGGCTCTGGG + Exonic
931261379 2:60622531-60622553 GATTTTGTGTCTCACCTCCTGGG + Intergenic
931624418 2:64243954-64243976 GCTTCTGTGTCCTCCCTTCTGGG - Intergenic
932475922 2:72005825-72005847 GCTTCTGTCTCTCAGTCTCTGGG - Intergenic
934886505 2:98030046-98030068 GCTTCAGTTTCTCGCCATATGGG + Intergenic
935715259 2:105933746-105933768 GCTACTGGGTCTCACCTCCTGGG + Intergenic
935897067 2:107748999-107749021 GCGACTGTGTTTCACCATGTTGG + Intergenic
938711610 2:133980134-133980156 GCTTCTTCATCTCACCATCAGGG - Intergenic
938950871 2:136253599-136253621 ACTTCAGATTCTCACCATCTTGG + Intergenic
941288385 2:163643765-163643787 GCTTCTGAGTTTCACCATATTGG - Intronic
942420667 2:175804135-175804157 GCTGCTCTGTGTCACTATCTAGG - Intergenic
945045255 2:205776225-205776247 TCTTCTGTGTCTCTCCACCAGGG + Intronic
945414142 2:209549879-209549901 GCTTCTCTTTCTCACCCTCTGGG + Intronic
945907507 2:215611861-215611883 GCTTCTGTATCTCTTCATCTTGG + Intergenic
947301301 2:228690672-228690694 TCTGCTGTGTCTCCCCAGCTAGG - Intergenic
948681383 2:239637307-239637329 GCCTCTGAGTCTCACCCACTTGG - Intergenic
1169947348 20:11003329-11003351 CCTTCTGTGTCTCAAAATCAGGG + Intergenic
1170710157 20:18783388-18783410 GCTCCTGGGTCTGCCCATCTTGG + Intergenic
1170895470 20:20409148-20409170 GCTTCTGACTCTCCCCATCCAGG - Intronic
1171143274 20:22760988-22761010 GCTTCTTTGGCTAAGCATCTGGG - Intergenic
1171483830 20:25473090-25473112 TCTTCTGTGTCTGACTTTCTTGG - Intronic
1172799550 20:37566401-37566423 GCTTCTGTGTCAAAAGATCTGGG - Intergenic
1174810774 20:53643707-53643729 GACTCAGTGTTTCACCATCTTGG + Intergenic
1177233574 21:18355780-18355802 GCTTCTCTATCTCACCAACTAGG + Intronic
1179658254 21:42859078-42859100 GCTTCTGTGTCCCAGCAATTGGG - Intronic
1180232295 21:46434444-46434466 GCCTCTGTGTGTCTGCATCTTGG + Intronic
1181770753 22:25123608-25123630 GCTTCAGTTCCTCACCATATGGG - Intronic
1181935922 22:26438235-26438257 GCCTCTGAGTCCCTCCATCTGGG + Intronic
1184611699 22:45607938-45607960 GCTTCTGGGTCCCACCCTCCAGG - Intergenic
953131388 3:40142743-40142765 GCTACTGAGTCTGACCAACTTGG + Intronic
954943247 3:54394004-54394026 GCTTCTGTGTCTCACCATCTGGG + Intronic
956776075 3:72566645-72566667 GCCTCAGTTTCTCACCACCTGGG + Intergenic
959742062 3:109731898-109731920 GCTTCTATGTTTCACAATTTAGG + Intergenic
960877628 3:122312906-122312928 GCTGCTGTGTTTCATAATCTGGG + Intergenic
960921572 3:122752236-122752258 GCTCCTCTTTCACACCATCTGGG - Intronic
963428628 3:145165950-145165972 CCCTCTTTGTGTCACCATCTAGG + Intergenic
966098385 3:176235048-176235070 GTTTCTGTTTCTCAGCATCATGG - Intergenic
966270540 3:178099200-178099222 ACTTCTGTATGTCATCATCTTGG + Intergenic
967608670 3:191478583-191478605 GTTTCTGAGTCTTACAATCTAGG - Intergenic
969572702 4:8019268-8019290 GCCTCTGTCCCTCACCATCTTGG + Intronic
970059662 4:12017977-12017999 GCAACTGTGTTTCACCATGTTGG - Intergenic
970108186 4:12608795-12608817 TCTTCTCTGTCTTACCATTTCGG + Intergenic
970432482 4:16001522-16001544 ACTTCTCTGCCTCATCATCTTGG - Intronic
971258968 4:25039017-25039039 GCTCCTGTGTGTCAGCATTTGGG - Intergenic
971265588 4:25093807-25093829 GCTTCTGGGCCTCTCCATCTGGG + Intergenic
971327849 4:25658630-25658652 GCCTGTGTGCCTCACCCTCTTGG - Intronic
975850412 4:78566101-78566123 GCTCCTGTGCCTCACCTCCTAGG - Intronic
983030160 4:162790793-162790815 ACTTCTTTCTCTCACCATCTAGG - Intergenic
987710792 5:21498975-21498997 GCTTCTGTGTCCCAAAATCCTGG + Intergenic
988300129 5:29413230-29413252 CTTTCTGTGTTTCACCATCAGGG + Intergenic
988946930 5:36213056-36213078 GCTTCAGTTCCTCACCATGTTGG - Intronic
990304581 5:54481870-54481892 GCTTCAGTCTCTCACTACCTTGG - Intergenic
990617819 5:57525212-57525234 GTTTCTGGGTCTCAGAATCTTGG + Intergenic
992641155 5:78769362-78769384 GCCTCTGGGTTTCACCATGTTGG - Intronic
994913601 5:105944609-105944631 GCTTCTTAGTATCATCATCTTGG - Intergenic
995761776 5:115570118-115570140 GTTGCTGTGTCTTTCCATCTAGG - Intergenic
996410286 5:123151466-123151488 ACTTCTCTGCCTCCCCATCTGGG - Intronic
999046443 5:148474686-148474708 ACTTCTGTCTCTCACCTTCTAGG + Intronic
999685993 5:154103652-154103674 TCTTCTGTGCAACACCATCTGGG + Intronic
1000037064 5:157456885-157456907 GCATCTGTCTCTCAGGATCTGGG + Intronic
1001983072 5:176049591-176049613 ACTTCAGGGTCTCACCATTTAGG - Intergenic
1002823848 6:754919-754941 GGATTTGTGTCTCTCCATCTGGG - Intergenic
1005328656 6:24727081-24727103 GCCTCAGTTTCTCACCATGTGGG + Intergenic
1005765529 6:29007479-29007501 GCTTCAGTTCCTCACCACCTGGG - Intergenic
1007076979 6:39074386-39074408 GCTTCTGCCTCTCACCACGTGGG + Intronic
1012065571 6:94546000-94546022 GTTTCTGTGTCTCTTCATCTTGG + Intergenic
1012932391 6:105330574-105330596 GCTGCGGTGTCTCTCCCTCTGGG - Intronic
1013833858 6:114308861-114308883 ACAACTGTGTCTCACCAACTTGG - Intronic
1017019718 6:150130496-150130518 GCTTCTTTGTCTCAGCTTCATGG + Intergenic
1017401942 6:154074571-154074593 GAGACTGTGTTTCACCATCTTGG - Intronic
1020891265 7:13880652-13880674 GCTTCTGTGGCTCACTTTTTAGG + Intergenic
1020996914 7:15277564-15277586 GCTTTATTGTCTCACCATCAAGG - Intronic
1021998865 7:26205704-26205726 GCTTCTCTGTATCACCCTTTAGG + Intronic
1023258301 7:38333995-38334017 TCTTCTGTGTCTCACCCTATAGG - Intergenic
1023887196 7:44367691-44367713 GCTACTGTGCTACACCATCTTGG + Intergenic
1024092686 7:45958587-45958609 GCCTCAGTTTCTCACCATGTGGG - Intergenic
1024222934 7:47302727-47302749 GCTTCTGTGTTTGGCCACCTTGG - Intronic
1024596982 7:50946734-50946756 GCTACTGTGCTACACCATCTTGG + Intergenic
1025008034 7:55370180-55370202 GCTTCAGTGTCTAACCACATGGG + Intronic
1026888495 7:73968475-73968497 GCTTCTGTCTCAGACCACCTGGG + Intergenic
1030736990 7:113060833-113060855 GCTCCTGTGTTTCCCAATCTTGG + Intergenic
1033358102 7:140617186-140617208 GCTTCTGTTTCAGAGCATCTTGG + Intronic
1034276928 7:149827978-149828000 GGTTCGGTGTCTCACCAGGTGGG - Intergenic
1034374106 7:150628117-150628139 GGTTCTGGGTCACACCATCCTGG - Exonic
1034715295 7:153236089-153236111 GCTTCATTGCCTCACCATGTGGG + Intergenic
1035926766 8:3736365-3736387 GCACCTGTGTCTCAGCTTCTTGG - Intronic
1036684019 8:10896648-10896670 GCTTCTGTCTTTCACCATTGTGG - Exonic
1037935892 8:22914841-22914863 GCTTCTCTGTGTCCCCTTCTTGG + Intronic
1038420961 8:27433836-27433858 GCCTGTGTGTGTCTCCATCTTGG + Intronic
1039695168 8:39902919-39902941 GCTCTTGTTTTTCACCATCTGGG + Intronic
1039975538 8:42361210-42361232 TCTTCTGTGTGTCATCAGCTTGG + Intronic
1043098955 8:76015372-76015394 ACTTCTAAGTTTCACCATCTAGG + Intergenic
1043629165 8:82307145-82307167 GCTTCAATGTCTCACCGCCTTGG - Intergenic
1045907621 8:107366957-107366979 GCCTCAGTTTCTCACCATGTGGG - Intronic
1046697822 8:117361770-117361792 GTTTCTCTCTCTCTCCATCTGGG - Intergenic
1047724791 8:127674636-127674658 GCCTCAGTTTCTCACCATGTAGG + Intergenic
1048577175 8:135701991-135702013 GCTACTGTGCTACACCATCTAGG - Intergenic
1048641084 8:136362497-136362519 GCTTTTGTACCTCACCCTCTGGG - Intergenic
1048903198 8:139060195-139060217 GCCTCTGTGTCTCAGCCTCAGGG + Intergenic
1050291349 9:4158543-4158565 ACTTCTGTATCTCAGCATATCGG - Intronic
1050608634 9:7327976-7327998 GCCTCAGTTTCTCACCATGTGGG - Intergenic
1051594132 9:18807073-18807095 GTTTCTGTGTCTGACTATCTTGG + Intronic
1052873639 9:33534219-33534241 GCTTATGTGTATAAGCATCTTGG - Intronic
1053380500 9:37645706-37645728 GCTTCTGTGTCCTAGAATCTTGG + Intronic
1053502452 9:38610539-38610561 GCTTATGTGTATAAGCATCTTGG + Intergenic
1053507982 9:38661209-38661231 GATTCGGTGTTTCACCATGTTGG + Intergenic
1057140169 9:92721941-92721963 TCCTCTGAGTCTCACCATCAGGG - Intronic
1057153636 9:92819091-92819113 GCTTATGTGTATAAGCATCTTGG - Intergenic
1057681850 9:97194969-97194991 GCTTATGTGTATAAGCATCTTGG + Intergenic
1058760008 9:108121486-108121508 GCTCCTGTGTCACGCTATCTGGG + Intergenic
1059733836 9:117082314-117082336 TCTTCAGTGGCTCACCTTCTTGG + Intronic
1060537083 9:124399264-124399286 GCTTCTGTGCCTCACTCTCAGGG - Intronic
1187621746 X:21063363-21063385 GCTACTGTGCTGCACCATCTTGG - Intergenic
1191064300 X:56331078-56331100 TCTTCTGTGTCGCACACTCTGGG + Intergenic
1194542962 X:95197528-95197550 TCTTGTGTGTCTCTTCATCTGGG + Intergenic
1196706412 X:118721220-118721242 GCCTCTGTGTCTTAGCATCCAGG - Intergenic
1197070005 X:122285329-122285351 GATACTGAGTTTCACCATCTTGG - Intergenic
1199331820 X:146569930-146569952 GCTTAGGTATCTCACCATTTTGG - Intergenic
1200179427 X:154141246-154141268 ACTTCTGGGTCTCACATTCTTGG + Intergenic
1200226177 X:154419150-154419172 TCTTCAGTGGCTCACCAGCTGGG - Intronic
1200894980 Y:8365924-8365946 GCTGCTGTCACTCACCATCAAGG + Intergenic
1201373974 Y:13296079-13296101 GCTTCTGTGTGGCAGCATCCAGG + Intronic
1201760147 Y:17528215-17528237 GAGACTGTGTTTCACCATCTTGG + Intergenic
1201841407 Y:18377775-18377797 GAGACTGTGTTTCACCATCTTGG - Intergenic