ID: 954943248

View in Genome Browser
Species Human (GRCh38)
Location 3:54394005-54394027
Sequence CTTCTGTGTCTCACCATCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 358}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954943245_954943248 -4 Left 954943245 3:54393986-54394008 CCATACAGGGTCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 954943248 3:54394005-54394027 CTTCTGTGTCTCACCATCTGGGG 0: 1
1: 0
2: 1
3: 33
4: 358
954943241_954943248 17 Left 954943241 3:54393965-54393987 CCTTGTTGCTGCTGCATGTGTCC 0: 1
1: 0
2: 3
3: 8
4: 225
Right 954943248 3:54394005-54394027 CTTCTGTGTCTCACCATCTGGGG 0: 1
1: 0
2: 1
3: 33
4: 358
954943240_954943248 29 Left 954943240 3:54393953-54393975 CCATTTTGGGTACCTTGTTGCTG 0: 1
1: 0
2: 1
3: 11
4: 171
Right 954943248 3:54394005-54394027 CTTCTGTGTCTCACCATCTGGGG 0: 1
1: 0
2: 1
3: 33
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954943248 Original CRISPR CTTCTGTGTCTCACCATCTG GGG Intronic
900682196 1:3923216-3923238 GTTCTGAGTCACTCCATCTGTGG + Intergenic
900706734 1:4085604-4085626 CTTAAGTGTCTCAACATGTGGGG - Intergenic
900900587 1:5513262-5513284 CTTGTGTGTCTCATCCTCAGGGG - Intergenic
901222202 1:7589606-7589628 CCTCTGTCGCTCAGCATCTGCGG + Intronic
902755959 1:18549348-18549370 CATCTGTGTTTCTCCAGCTGGGG - Intergenic
905208119 1:36354620-36354642 AGTCAGTGTCTCCCCATCTGTGG + Intronic
906421562 1:45672500-45672522 CTTCTGTCTCTCATTATTTGTGG - Intronic
907667832 1:56449024-56449046 CTTCTGAGTCTCACTTCCTGGGG + Intergenic
907690190 1:56656907-56656929 CTGCTGTGTATGACCATCAGTGG - Intronic
909601577 1:77466712-77466734 CTTCTGTGTTCCAACATGTGAGG - Intronic
911659357 1:100483135-100483157 ATTCTGTGTCTCACTCTTTGAGG + Intronic
911689763 1:100820097-100820119 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
914222245 1:145691541-145691563 CTTCTGTGTCTATCCACCAGAGG - Intronic
914458690 1:147861772-147861794 CTTCTTTGGCTCACCCTCTGTGG - Intergenic
914717943 1:150267254-150267276 CTTCTTTGGCTCAACATCTCAGG - Intronic
915600940 1:156923024-156923046 CTCCTGTGTCTGGCCATCAGTGG - Intronic
915771861 1:158433346-158433368 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
918159258 1:181882367-181882389 CTGCTTTGGCTCACCTTCTGTGG - Intergenic
918537142 1:185586544-185586566 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
919313694 1:195945466-195945488 CTTCTCTTTCTAACCATCTTAGG - Intergenic
919598497 1:199593671-199593693 CTTCTGTGTCTAGCCATCCAGGG - Intergenic
921296943 1:213712813-213712835 CTACTTTGGCTCACCCTCTGTGG + Intergenic
921620108 1:217315827-217315849 CATCTGTGTCCCCCCTTCTGAGG + Intergenic
921938389 1:220815515-220815537 CTTCTGTGCCTCACAGTGTGAGG + Exonic
922098441 1:222462222-222462244 CTTCTGTTTCCCACCACCTCAGG + Intergenic
923331674 1:232931122-232931144 CCTCTGTGTCTAACCATCAAGGG - Intergenic
924543325 1:245001633-245001655 CTTCAGTGCCCCACCATCTACGG - Intronic
1062923764 10:1299213-1299235 CTTGTGGGTTTCCCCATCTGGGG - Intronic
1063442985 10:6088800-6088822 CTTCTCCTCCTCACCATCTGGGG + Intergenic
1064269906 10:13855335-13855357 CCTCTGTGTCTGAAGATCTGAGG + Intronic
1065153267 10:22844147-22844169 CTCCAGTTTCCCACCATCTGGGG + Intergenic
1065156982 10:22880796-22880818 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
1065281824 10:24146819-24146841 CTGCTTTGTCTCTCCATCTTTGG - Intronic
1065671347 10:28121760-28121782 TCTCTGAGTCTCACTATCTGTGG + Intronic
1065798867 10:29332674-29332696 CTTCTGGCTCACACCATTTGTGG - Intergenic
1066331725 10:34430876-34430898 CCTCTGTGTCACACCCTGTGAGG - Intronic
1066825595 10:39570627-39570649 CTTCTGTCTATCACTATATGAGG - Intergenic
1066904227 10:41166213-41166235 CTTCTGTCTATCACTATATGAGG - Intergenic
1067681957 10:48447056-48447078 CTTCTGTGGGTCACCACGTGTGG - Intronic
1067892988 10:50152144-50152166 CCTCTGTCTCTTACCTTCTGAGG + Intergenic
1069125045 10:64619623-64619645 CTTCTCTGTGTTAGCATCTGTGG - Intergenic
1069349059 10:67503268-67503290 CTGCTTTGGCTCACCCTCTGTGG + Intronic
1071431724 10:85612001-85612023 CTTCTGTGTATCTCCATGTAAGG - Intronic
1072636888 10:97184215-97184237 TTTCTGTCTCTGACCAGCTGGGG + Intronic
1074017094 10:109545478-109545500 CTGCTGTGGCTCACCCTCTGTGG - Intergenic
1074017245 10:109546436-109546458 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
1074293470 10:112159545-112159567 CTTCTGACTCTTACCATCTGTGG + Intronic
1076247019 10:128955152-128955174 CTTCTGAGTCGCAGCATCTTTGG + Intergenic
1076433044 10:130420869-130420891 CTGATGAGTCCCACCATCTGTGG + Intergenic
1076591004 10:131581948-131581970 CTACTTTGGCTCACCCTCTGTGG + Intergenic
1076758597 10:132588745-132588767 CTGGTGTGTGTCACCATCGGTGG + Intronic
1077075312 11:698515-698537 TGTCTGTGGCTCACCGTCTGTGG - Intronic
1077462068 11:2715643-2715665 CTTCTGTGTTTGACCACCTGGGG - Intronic
1077556431 11:3228219-3228241 CTGCTGTGTTGCACCATGTGTGG - Exonic
1077611287 11:3644552-3644574 CTTCTTTAACTCAGCATCTGAGG - Intergenic
1077854976 11:6115542-6115564 CTTCTTTTTCTCACTCTCTGTGG - Intergenic
1080109361 11:28548056-28548078 TTTCTTTCTCTCCCCATCTGGGG + Intergenic
1081517305 11:43845679-43845701 CTTCTGTGTCTCCCCACGTGAGG - Intronic
1081768211 11:45627730-45627752 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
1082127880 11:48453938-48453960 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
1084686357 11:70698082-70698104 CACCTGTGTGTCACCAGCTGTGG - Intronic
1084774084 11:71364210-71364232 CATCTGTCCCTCTCCATCTGTGG - Intergenic
1086612916 11:88778430-88778452 CTGCTTTGGCTCACCCTCTGTGG + Intronic
1087224048 11:95578284-95578306 CTTCTGTCCCTCACCATGTGAGG - Intergenic
1087979562 11:104594196-104594218 CTTGTGTGTGTCACCACGTGTGG + Intergenic
1088821077 11:113457933-113457955 CTGCTGTGTCCCACCCACTGGGG - Intronic
1090271703 11:125390535-125390557 CTTCAGTGTCTCACCGTAGGTGG + Intronic
1090479602 11:127056470-127056492 CTTCTGTGTGGCAGCAGCTGGGG + Intergenic
1092138591 12:6167167-6167189 CCTCTGTGTCCTACCCTCTGTGG - Intergenic
1092926436 12:13276447-13276469 CTTCTGTCCCACCCCATCTGGGG - Intergenic
1093004332 12:14035615-14035637 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
1093542628 12:20305232-20305254 CTACCATGTCTCACCATCTCAGG + Intergenic
1094885055 12:34857881-34857903 CTTCTGTGTAACATTATCTGAGG - Intergenic
1094930824 12:35599209-35599231 CTTCTGTGTCACATTATATGAGG - Intergenic
1094987408 12:36514690-36514712 CTTCTGTGTATCATTATATGAGG - Intergenic
1094991583 12:36582633-36582655 CTTCTGTGTAACATTATCTGAGG - Intergenic
1094991751 12:36585346-36585368 CTTCTGTGTCACATTATATGAGG - Intergenic
1094994148 12:36623728-36623750 CTTCTGTGTAACATTATCTGAGG - Intergenic
1094997898 12:36684052-36684074 CTTCTGTGTAACATCATATGAGG - Intergenic
1095020571 12:37051569-37051591 CTTCTGTGTCACATTATATGAGG - Intergenic
1095027406 12:37161960-37161982 CTTCTGTGTAACATTATCTGAGG - Intergenic
1095128263 12:38508018-38508040 CTCCTTTGGCTCACCCTCTGTGG - Intergenic
1095554428 12:43483461-43483483 CTTCTCCCCCTCACCATCTGTGG + Intronic
1095706492 12:45242550-45242572 CTGCTTTGGCTCACCCTCTGTGG + Intronic
1096866775 12:54569155-54569177 CCTCTGTGACTCCCCTTCTGGGG + Intronic
1096899124 12:54856205-54856227 CATATTTGTCTCACCCTCTGTGG - Intronic
1097364889 12:58701470-58701492 CTGCTTTGGCTCACCCTCTGTGG - Intronic
1097427915 12:59470299-59470321 CTTCTGATTTTCACCATGTGAGG - Intergenic
1097439104 12:59587606-59587628 GCTCTGGGTCTCACAATCTGGGG - Intergenic
1097755737 12:63405026-63405048 CTTCTGTGTCTCCCAAATTGAGG + Intergenic
1099378690 12:81926760-81926782 CTTGTGTGTCTCTCCAGTTGTGG + Intergenic
1099740329 12:86626885-86626907 CTGCTTTGGCTCACCCTCTGTGG - Intronic
1099807499 12:87538103-87538125 CTCTTGTGTCTCATCACCTGAGG - Intergenic
1100433741 12:94552925-94552947 CTTCTGTGTTTTAGCATCTTGGG + Intergenic
1100748612 12:97672719-97672741 CTGCTTTGACTCACCCTCTGTGG - Intergenic
1105249054 13:18679863-18679885 CTTCTGCATCTCACCTTCTGAGG - Intergenic
1106426679 13:29636960-29636982 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
1106820086 13:33455148-33455170 CTTCTGTGTGTCACAGTCTGTGG - Intergenic
1106846339 13:33741684-33741706 CTACTGTGTTTCTCCATCTATGG + Intergenic
1108743747 13:53367678-53367700 CTTTTGCTCCTCACCATCTGTGG + Intergenic
1108936055 13:55880885-55880907 CTTTTTTGTCTGTCCATCTGGGG + Intergenic
1110658445 13:78029172-78029194 CTTCAGTGTCTCAGCATCCTAGG + Intergenic
1112416214 13:99205489-99205511 CTTCTGAATCTGACCCTCTGGGG - Intronic
1112453966 13:99540926-99540948 CTGCTGTGACTCACAATCAGTGG - Intronic
1113048737 13:106185120-106185142 CTTTTCTCTCTCAGCATCTGTGG - Intergenic
1113367374 13:109688972-109688994 CGTCTGCATCTCACCATCAGAGG + Intergenic
1113790763 13:113026852-113026874 GTTCTGTGTCTCCCCAGCGGCGG + Intronic
1115218684 14:31037566-31037588 CTTCTGTATCTCACAATCTTTGG - Intronic
1115511181 14:34139481-34139503 CTGCTTTGGCTCACCCTCTGTGG - Intronic
1116125239 14:40775535-40775557 CCTTTGTATCTCACCATTTGAGG + Intergenic
1116511967 14:45757056-45757078 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
1116771565 14:49132090-49132112 CTTCTTCGGCTCACCCTCTGTGG + Intergenic
1117087601 14:52217905-52217927 CTTCTGTCTTCCACCATGTGAGG - Intergenic
1118553425 14:66983824-66983846 TGTCTGTCTCTCTCCATCTGTGG - Intronic
1120092911 14:80354195-80354217 CTTCAGTGGTTCACCATCTATGG + Intronic
1120546180 14:85814073-85814095 CTTAGTTTTCTCACCATCTGGGG - Intergenic
1121029979 14:90649916-90649938 ATTCTGGGTCTCTCCCTCTGGGG - Intronic
1121929276 14:97957625-97957647 CTTGTCTTTCTCCCCATCTGGGG + Intronic
1122842967 14:104475735-104475757 CATCTGCCTCTCACCAGCTGTGG + Intronic
1124603782 15:31155363-31155385 CTTCCTTGTCTAACCATGTGTGG - Intronic
1124785884 15:32680141-32680163 TTTCTGTGTCTCCCCTTCTTTGG + Intronic
1124909727 15:33907254-33907276 CCTCTGTGTCCCATCATTTGAGG - Intronic
1125288429 15:38119562-38119584 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
1125493645 15:40168877-40168899 TTTCAGAGTCTCACCTTCTGAGG + Intronic
1125514645 15:40311209-40311231 CATCTGTGCCTCATCAGCTGGGG - Intergenic
1127053835 15:55112151-55112173 CTTCTCTGTCTCCCCAACTTTGG - Intergenic
1127388587 15:58487199-58487221 CAGCTGGGACTCACCATCTGGGG - Intronic
1127608027 15:60609647-60609669 CTTCTGTGTCTTCCCATTTTGGG - Intronic
1128102108 15:65010750-65010772 CTTCTGTGTTTCACTTTTTGAGG + Intronic
1128608599 15:69056612-69056634 CTTCTGTGGCTCCCCAGCTCTGG + Exonic
1129587921 15:76887320-76887342 CTGCTTTGGCTCACCCTCTGTGG - Intronic
1130819550 15:87479927-87479949 CTTCTGTAGCTGAGCATCTGTGG + Intergenic
1131589320 15:93731186-93731208 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
1132930622 16:2457290-2457312 CTTCCGTGTCTCACTGTCTCTGG + Exonic
1134322020 16:13172527-13172549 CCTCTCTGTGTCACCATCTAGGG + Intronic
1134541059 16:15066071-15066093 CTTCTGTCACTCTCCATCTCAGG + Intronic
1135436511 16:22430615-22430637 CTTCTGTCACTCTCCATCTCAGG + Intronic
1136488840 16:30591553-30591575 CTTGTGCATCTCACCATCTGAGG - Intergenic
1136727644 16:32373666-32373688 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
1138627954 16:58267260-58267282 CTTCTTTGCCTCTCCAGCTGAGG + Intronic
1139034750 16:62930515-62930537 CTTCTGTATCACAGAATCTGTGG + Intergenic
1140645176 16:77022184-77022206 CTTATGTTTCTGACCATGTGTGG - Intergenic
1140882689 16:79213262-79213284 CTTCTGTGCCTCTGCATCTGTGG + Intergenic
1141639357 16:85332574-85332596 CTTCTCAGTCCCACCAGCTGAGG - Intergenic
1202998788 16_KI270728v1_random:144084-144106 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
1203130387 16_KI270728v1_random:1680492-1680514 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
1143104518 17:4522281-4522303 ATTCTGTGTCTCACCTTCAGTGG - Intronic
1145953219 17:28836448-28836470 CTTCTTTAACTCAGCATCTGAGG - Intronic
1149684251 17:58526431-58526453 CTTCTGTGAGTTCCCATCTGAGG + Intronic
1150608951 17:66717798-66717820 CTTCTGTGGCTGACAGTCTGTGG + Intronic
1151518733 17:74613807-74613829 CTGCTGTTTCTCTCCATCTCTGG - Intronic
1152046024 17:77936381-77936403 CTTCTCTTTCTCACCGTCAGTGG + Intergenic
1152243994 17:79175858-79175880 CGTCTGTGTCTAAGCCTCTGAGG - Intronic
1154362884 18:13678780-13678802 CTTGTGTGTTTCTTCATCTGTGG - Intronic
1154439829 18:14379367-14379389 CTTCTGCATCTCACCTTCTGAGG + Intergenic
1156640958 18:39098161-39098183 CTTCTGTATTCCACCATGTGAGG - Intergenic
1157177511 18:45465021-45465043 TTTCTGTCTCTCTCCTTCTGAGG - Intronic
1157396729 18:47347768-47347790 CTTCTGTTGCTCATCTTCTGGGG - Intergenic
1157695193 18:49716753-49716775 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
1158703660 18:59771499-59771521 CTGCTTTGGCTCACCATCTGTGG - Intergenic
1158929076 18:62303214-62303236 CTTCTGATTCTTTCCATCTGAGG - Intronic
1159706643 18:71697747-71697769 CTTCTGTCTTTCATCATGTGAGG - Intergenic
1159985042 18:74831820-74831842 CTGCTGTGTGTCACCGTGTGTGG + Intronic
1161171526 19:2814628-2814650 CTTCTGTGTCTTTCCAACTCTGG + Exonic
1161605723 19:5213861-5213883 CATCTGTTTTTCTCCATCTGTGG - Intronic
1161747095 19:6067485-6067507 CTTGTGTGTCCTGCCATCTGGGG - Intronic
1164420564 19:28088185-28088207 CTTCTGTGGCTCCACCTCTGGGG + Intergenic
1165540614 19:36490117-36490139 CTTCTGAGTCTCACAACCTCTGG - Intergenic
1167533618 19:50034646-50034668 CTTCTGTGTCTCTTAATCTTTGG + Intronic
1168345624 19:55648962-55648984 CATCTGCGTCTCTCCATTTGTGG + Exonic
927286429 2:21361820-21361842 ATTCTCTGTCTAGCCATCTGGGG + Intergenic
928097831 2:28415486-28415508 CTTCTGTTTCTCAGGCTCTGGGG + Exonic
928237028 2:29552393-29552415 CTTCTATGTCTAACCCTGTGAGG + Intronic
929030740 2:37648183-37648205 CTTCTCTGTGTCAGCATCAGAGG - Intronic
930941676 2:57021841-57021863 CTTCTTTGGCTCACCCTCTGTGG - Intergenic
931004014 2:57827762-57827784 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
931457844 2:62426155-62426177 CTTCTGTTTCTGAGCCTCTGGGG - Intergenic
931624417 2:64243953-64243975 CTTCTGTGTCCTCCCTTCTGGGG - Intergenic
931770311 2:65491534-65491556 CTTCTGAGTATCACCATGGGTGG + Intergenic
931925125 2:67064199-67064221 CTTCTCTGTCTCCCTAACTGTGG + Intergenic
933200194 2:79439016-79439038 CTTCTGTGTTTAACCTTTTGAGG - Intronic
933422080 2:82061697-82061719 CTTCTGTGACTCCACATATGGGG + Intergenic
935715260 2:105933747-105933769 CTACTGGGTCTCACCTCCTGGGG + Intergenic
936809798 2:116384352-116384374 CTTTTCTGTCTCACCAAATGAGG - Intergenic
937010388 2:118557733-118557755 ATTCTGTATCTCACTATTTGGGG - Intergenic
937280158 2:120712281-120712303 CTTCTGTGGATCACCTTCAGAGG - Intergenic
939103429 2:137922148-137922170 CTTCTGCATCTCACCTTCTGAGG - Intergenic
939623027 2:144444473-144444495 ACTCTGTGTGTCACCAGCTGGGG + Intronic
939994120 2:148904250-148904272 TTGCTGTGTCTCAGCATCGGGGG + Intronic
940720795 2:157279795-157279817 CTGCTTTGGCTCACCCTCTGTGG + Intronic
941033836 2:160544384-160544406 CTTCTGTCTCCTACCATGTGAGG + Intergenic
942202197 2:173582576-173582598 TCTCTGTGTCTCACCTTCTGTGG + Intergenic
942617708 2:177811572-177811594 TTTCTATTTCTCACCATGTGTGG + Intronic
942732512 2:179075741-179075763 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
943548009 2:189305452-189305474 CTTCTGCCTTTCACCATGTGAGG + Intergenic
944165126 2:196710479-196710501 CTGCTTTGGCTCACCCTCTGTGG + Intronic
944892399 2:204131019-204131041 CTTCTGTGTCACAAAATGTGGGG - Intergenic
945045256 2:205776226-205776248 CTTCTGTGTCTCTCCACCAGGGG + Intronic
945161918 2:206900208-206900230 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
945299374 2:208201321-208201343 CTTCCCTGACTCACCATTTGTGG + Intergenic
945420817 2:209633895-209633917 CTTCTGTTTTTTACCATCTCAGG + Intronic
945533809 2:210987287-210987309 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
946121625 2:217520850-217520872 CTTCAGTTTGTCACCATATGTGG + Intronic
946294515 2:218773230-218773252 CTGCTTCGTCTCACCCTCTGTGG + Intergenic
946549320 2:220783197-220783219 CTTCTGTATCTGACCAGCTGAGG + Intergenic
946603255 2:221374220-221374242 CTTCAGTGTCACACCACTTGAGG - Intergenic
947492038 2:230603485-230603507 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
948280719 2:236745984-236746006 ATTCTGTGTCTCACGCCCTGGGG - Intergenic
1169307139 20:4501803-4501825 CTGCTTTGTCTCGCCCTCTGTGG + Intergenic
1169475836 20:5930427-5930449 CCTCAGTGTCTCTCCACCTGAGG - Intergenic
1169546770 20:6658524-6658546 CCTTTGAGTCTGACCATCTGAGG - Intergenic
1171050450 20:21853578-21853600 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
1171143273 20:22760987-22761009 CTTCTTTGGCTAAGCATCTGGGG - Intergenic
1171173389 20:23034658-23034680 CTTCTGTGTCCGAGCAGCTGAGG - Intergenic
1172426876 20:34861558-34861580 CTTCTGTGTCTCTCCCAGTGGGG - Exonic
1174393281 20:50231363-50231385 CTTCTGTGGGGAACCATCTGGGG - Intergenic
1175071349 20:56336612-56336634 CTGCTTTGACTCACCATCTGTGG - Intergenic
1176455914 21:6910404-6910426 CTTCTGCATCTCACGTTCTGAGG - Intergenic
1176834088 21:13775452-13775474 CTTCTGCATCTCACGTTCTGAGG - Intergenic
1177103611 21:16926059-16926081 CTTCTGTTTTTCTCCATGTGAGG + Intergenic
1177425806 21:20921920-20921942 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
1177686456 21:24443354-24443376 CTTCTGCCTCCCACCATGTGAGG + Intergenic
1179454143 21:41486984-41487006 GTTCTGTTTCTCACCTTTTGAGG - Intronic
1180118082 21:45725415-45725437 CATCTGTGCCTCCACATCTGTGG - Intronic
1180590393 22:16932258-16932280 CTTCTGGGTCACAACATCAGAGG - Intergenic
1181588777 22:23869881-23869903 CTTTTGTCTTTCACCATATGAGG - Intronic
1182425838 22:30271744-30271766 CCTCTGTGTTTAACCATTTGCGG - Intergenic
1182432592 22:30309056-30309078 CTTCTGTGTGGCTCCATCTCTGG + Intronic
1183829480 22:40410205-40410227 CTGTTGTGTCCCAGCATCTGAGG - Exonic
1185179672 22:49351940-49351962 CTTCAGCGTCCCGCCATCTGGGG - Intergenic
950574281 3:13822177-13822199 ATTCTGTGTCTAACATTCTGAGG - Intronic
950954475 3:17036865-17036887 CTTCTGTCTCCCACCACGTGAGG - Intronic
951567795 3:24028953-24028975 CTCCTCAGTCTCTCCATCTGAGG + Intergenic
951926437 3:27913510-27913532 CTTCTGTGTGTCTGCTTCTGTGG + Intergenic
952831885 3:37571833-37571855 CCATCGTGTCTCACCATCTGAGG + Intronic
953287727 3:41629215-41629237 CTTTTGTGTCTTCCCAGCTGAGG - Intronic
953407923 3:42668876-42668898 CCTCAGTGACTCAACATCTGTGG + Intergenic
954943248 3:54394005-54394027 CTTCTGTGTCTCACCATCTGGGG + Intronic
955957866 3:64309026-64309048 CTTCTGTATCCCATCATGTGAGG + Intronic
956142672 3:66161435-66161457 CTTCTGTGGCTCACCATTTCTGG - Intronic
956984120 3:74677291-74677313 CTTCTGTGTTGAGCCATCTGAGG - Intergenic
958793505 3:98681658-98681680 CTGCTTTGGCTCACCCTCTGCGG - Intergenic
958957865 3:100480548-100480570 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
958986104 3:100781522-100781544 CTCCTGTGTCTCACTGTCAGGGG + Intronic
959025567 3:101236541-101236563 CTACTTTGGCTCACCCTCTGTGG - Intronic
959349811 3:105248139-105248161 CTTCTGTGTCTGAATATTTGTGG + Intergenic
960565771 3:119130223-119130245 CTGCTTTGGCTCACCCTCTGTGG - Intronic
961431070 3:126883482-126883504 CTTCTGTGACTCAGAATATGTGG - Intronic
961593686 3:127999785-127999807 ATTCTGTGTCTCCCCTTCTGTGG - Intergenic
963014053 3:140803586-140803608 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
965678403 3:171224156-171224178 ATTTTGTCTCTCTCCATCTGTGG - Intronic
966198222 3:177334826-177334848 ATTCTGAGTCTCAGCATCTACGG - Intergenic
967983013 3:195076920-195076942 CTTCTGAGTGTCACCTTTTGTGG - Intronic
968442574 4:631582-631604 GATCTGTGTGGCACCATCTGAGG + Intronic
969442729 4:7226866-7226888 CTTCTGGGTCTCCTCATCTCTGG + Intronic
969537511 4:7765759-7765781 CTTCTGTGCCTCAGCCACTGAGG + Intronic
969694860 4:8728768-8728790 CTTCTGTCTCACAGCACCTGGGG - Intergenic
970429333 4:15974269-15974291 CTTCTGTCTCCCACAGTCTGCGG - Intronic
970771234 4:19615044-19615066 CTTCTGTATCTCCACATCTCTGG + Intergenic
971187551 4:24395076-24395098 CTTCTGCCACTCACCAGCTGTGG + Intergenic
971697804 4:29929456-29929478 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
971883155 4:32409223-32409245 CTGCTTTGGCTCACCCTCTGCGG - Intergenic
971916572 4:32877370-32877392 CTTTTGTTTTTCACCATCTTTGG + Intergenic
975365005 4:73518813-73518835 CTACTTTGGCTCACCCTCTGTGG + Intergenic
976117584 4:81744317-81744339 CTCCTGTGCCTCCTCATCTGTGG + Intronic
978174800 4:105716956-105716978 CTTATGTGTCTTCCCATCTCAGG - Intronic
978652309 4:111020592-111020614 CTTCTATGTGTCATCATCTGAGG + Intergenic
979263859 4:118679077-118679099 CCTGTGTCTCTCTCCATCTGCGG + Intergenic
979272914 4:118783081-118783103 CTGCTTTGGCTCACCCTCTGTGG + Intronic
979757578 4:124361387-124361409 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
983399241 4:167242971-167242993 GGTCTGTGTCTCACCATATTTGG + Intergenic
984269920 4:177537412-177537434 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
984560359 4:181261404-181261426 CTTTTGTGTCTCACTCACTGAGG - Intergenic
985843984 5:2330494-2330516 CATCTGTGGCACAGCATCTGTGG - Intergenic
985889090 5:2701778-2701800 CTTCTTTCTCTCACCGTGTGAGG + Intergenic
986288332 5:6377924-6377946 CTTCGGAGCCTCACCTTCTGAGG + Intronic
987642836 5:20633871-20633893 CCACTGAATCTCACCATCTGGGG + Intergenic
987702927 5:21425132-21425154 CTTCAGTTGCTCACTATCTGTGG + Intergenic
988671718 5:33388826-33388848 CTGCTTTATCTCACCCTCTGTGG - Intergenic
988829641 5:34974936-34974958 ATTCTGTGATTAACCATCTGAGG + Intergenic
989453100 5:41609774-41609796 CTTCTTTGGCTCACTCTCTGTGG + Intergenic
989670243 5:43908840-43908862 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
990395424 5:55373910-55373932 CTTCTGTGACTCAATATGTGAGG - Intronic
990721400 5:58699941-58699963 CTGCTTTGGCTCACCCTCTGTGG + Intronic
990824462 5:59882032-59882054 CTTCTGTTTCTCACAAACTGTGG + Intronic
991026757 5:62037958-62037980 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
991223493 5:64242929-64242951 CTGCTTTGGCTCACCCTCTGTGG - Intronic
991426627 5:66498960-66498982 CATGTCTGTATCACCATCTGGGG + Intergenic
992382694 5:76254406-76254428 CTTCTGTCTCACTCCAGCTGGGG - Intronic
993894902 5:93522686-93522708 CTGCTTTGGCTCACCGTCTGTGG - Intergenic
995459721 5:112390212-112390234 CTGCTTTGGCTCACCCTCTGTGG - Intronic
997202494 5:132020048-132020070 CTTCTGTTTCTTTCCCTCTGGGG - Intergenic
997700141 5:135891720-135891742 CTTCTAAATCTCACCACCTGTGG + Intergenic
998158934 5:139802202-139802224 CTTCTCTGCCTCCCCAACTGTGG - Intronic
998330746 5:141324329-141324351 CATCTGTGGCTGACCATCTGTGG - Intergenic
999488799 5:152027307-152027329 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
1000242947 5:159425612-159425634 CCTCTGTATCTCCCCATTTGAGG - Intergenic
1000440308 5:161255063-161255085 CTTCTCTGTCTAACCCTCAGTGG - Intergenic
1000702994 5:164476336-164476358 CTTCTCTCTCTCTCTATCTGTGG - Intergenic
1002200387 5:177524573-177524595 CTTCTGTGGCTTCCCACCTGAGG + Exonic
1002378949 5:178811182-178811204 TTTCTGTATCCCATCATCTGTGG - Intergenic
1003339661 6:5207413-5207435 TTTCTGTGTTGCACCCTCTGTGG - Intronic
1004056016 6:12139502-12139524 CTGCTTTGGCTCACCCTCTGTGG - Intronic
1006816066 6:36850816-36850838 CTTCTGTGTTTCATGGTCTGTGG - Intergenic
1007421093 6:41720261-41720283 GATCTGGGTCTCATCATCTGAGG + Intronic
1008464405 6:51814670-51814692 CTCCTGTGGCTCAGCACCTGAGG - Intronic
1010290458 6:74130734-74130756 CCTGTGTGGCTCACCATGTGAGG - Intergenic
1010454646 6:76040717-76040739 CTTATGTGTCTCATTTTCTGTGG - Intronic
1011176324 6:84564987-84565009 CTTCTGAGTCTTTCCATCTCTGG - Intergenic
1011225954 6:85107375-85107397 CTTCTATGTCTCAACATAAGTGG - Intergenic
1011337013 6:86272496-86272518 CTTCTTTGTCTCACCCTCCGTGG + Intergenic
1012133833 6:95530574-95530596 CTTCTATCTCTCAGTATCTGTGG - Intergenic
1012305244 6:97647956-97647978 CTTCTCTTTCTTACCTTCTGAGG + Intergenic
1012863603 6:104591971-104591993 CTTCTGTCTCACACCCTCTATGG - Intergenic
1013812352 6:114059361-114059383 AATCTGTGTCTCCCCCTCTGTGG + Intronic
1013833857 6:114308860-114308882 CAACTGTGTCTCACCAACTTGGG - Intronic
1013940350 6:115653454-115653476 CTCCTCTGTCTCACATTCTGTGG - Intergenic
1013956831 6:115852143-115852165 CTGCTATGGCTCACCCTCTGTGG - Intergenic
1014512335 6:122339273-122339295 CTTCTGTGTCCCCACATTTGTGG + Intergenic
1015547766 6:134379022-134379044 CTTCTGTGGCTCCCTCTCTGTGG - Intergenic
1016691617 6:146943879-146943901 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
1017197508 6:151717157-151717179 CTGCTTTGGCTCACCCTCTGTGG + Intronic
1018754489 6:166837495-166837517 CCTCTGTGTCTGTCCACCTGAGG + Intronic
1018942090 6:168315224-168315246 CTTCTGTGTCTCTCCCGCTGTGG + Intronic
1019058577 6:169240192-169240214 CTCCTGTTTCTAACCAACTGGGG + Intronic
1019837711 7:3406504-3406526 CTTCTCTCTCTCTCCAACTGTGG + Intronic
1019875842 7:3809834-3809856 TTTCTGTGTCTCACTTTCTGCGG - Intronic
1020815910 7:12905854-12905876 ATTCTGTGTTTCACCTTTTGAGG - Intergenic
1024659989 7:51484376-51484398 CTTCTGTGTCCCTGAATCTGCGG + Intergenic
1025064094 7:55838334-55838356 TTTCTGTTTCACACCATCAGTGG + Intronic
1026311582 7:69190426-69190448 CTACTGAGTCTCTCCATCTGAGG + Intergenic
1027165076 7:75828558-75828580 CTTCTGGGCCTCCCCAGCTGTGG - Intergenic
1027166141 7:75835634-75835656 CTTCTGGGCCTCCCCAGCTGTGG + Intergenic
1027701746 7:81478606-81478628 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
1028142700 7:87290040-87290062 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
1028801499 7:94970469-94970491 CTGCTTTGTCTCACTGTCTGTGG + Intronic
1031540123 7:122985341-122985363 CTTCTGTGTCACACAATTTTTGG - Intergenic
1031847547 7:126824560-126824582 CTTATGTGTCCTACCAACTGTGG + Intronic
1033283959 7:140025076-140025098 CTTCTGAGTGGCAGCATCTGAGG + Intronic
1034097589 7:148424533-148424555 CTGCTCTGGCTCACCCTCTGTGG - Intergenic
1034276927 7:149827977-149827999 GTTCGGTGTCTCACCAGGTGGGG - Intergenic
1034480376 7:151315223-151315245 ATTCTGAGTCTCACCACCAGAGG + Intergenic
1035914179 8:3600641-3600663 TTTCTGTCTCTTATCATCTGGGG - Intronic
1037050189 8:14362672-14362694 CTGCTTTGGCTCACCCTCTGCGG + Intronic
1039624387 8:39032647-39032669 CTGCTTTGGCTCACCCTCTGTGG + Intronic
1039695169 8:39902920-39902942 CTCTTGTTTTTCACCATCTGGGG + Intronic
1041350437 8:56942833-56942855 ATTTTGAGTCTCACCCTCTGAGG - Intergenic
1041810435 8:61902579-61902601 CTTCTCTGCCTCACCTTCTTTGG - Intergenic
1042645329 8:70980238-70980260 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
1044809105 8:96039092-96039114 CTGCTTTGACTCACCCTCTGTGG + Intergenic
1045673718 8:104586706-104586728 CTTCTGTCTCTAACCATATGTGG - Intronic
1045933561 8:107654225-107654247 CTACTTTGGCTCACCCTCTGTGG + Intergenic
1046277724 8:111985428-111985450 CTTCTTTGGCTCACCCTCTGTGG - Intergenic
1046825797 8:118690132-118690154 CTTCTGTGTCTTTGCATGTGAGG + Intergenic
1047012678 8:120689218-120689240 CACCTGTGTGTCACCAACTGAGG + Intronic
1047536115 8:125721186-125721208 CTTCTGTGTTCCACCATGTGAGG - Intergenic
1048178763 8:132176551-132176573 TTCCTGTATCTGACCATCTGCGG + Intronic
1048641083 8:136362496-136362518 CTTTTGTACCTCACCCTCTGGGG - Intergenic
1050291348 9:4158542-4158564 CTTCTGTATCTCAGCATATCGGG - Intronic
1050669884 9:7984053-7984075 CATCTGTGTTTCAACATCTGTGG - Intergenic
1050678727 9:8085457-8085479 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
1051504293 9:17810803-17810825 CTTCCATGCCTCTCCATCTGTGG + Intergenic
1051853054 9:21531308-21531330 CTTCTGTGTCTAAACCTTTGTGG + Intergenic
1052186325 9:25600438-25600460 CTTCTGTGTGTCAGGAACTGTGG + Intergenic
1052382420 9:27785485-27785507 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
1052770457 9:32684277-32684299 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
1052784761 9:32818220-32818242 TTTCTGTGACTTTCCATCTGAGG + Intergenic
1052799985 9:32957949-32957971 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
1053124278 9:35567071-35567093 CTTTTGTTTCTCACCATCTGAGG - Intergenic
1057066666 9:92059626-92059648 CTGGTGTGCCTCACCATCAGTGG + Intronic
1057452681 9:95178641-95178663 CGTCTGTGTTTCTCCAGCTGTGG + Intronic
1058760009 9:108121487-108121509 CTCCTGTGTCACGCTATCTGGGG + Intergenic
1059025901 9:110629464-110629486 CTTCCGTTTATCATCATCTGTGG - Intergenic
1060409407 9:123390202-123390224 CTTCTCTTTCTCCCCAGCTGGGG + Intronic
1186208447 X:7224797-7224819 CTTCTGGGTCTAATCGTCTGTGG + Intronic
1186642200 X:11467690-11467712 CCACTGTGTCTCACCAGCTTTGG - Intronic
1187621623 X:21062650-21062672 CTGCTGTGTCTCACCCTTTTAGG - Intergenic
1188089913 X:25952323-25952345 CTGCTGTGTCCCATCATCTAAGG - Intergenic
1189180614 X:39001273-39001295 TTCCTGTGTCTCACCAGCAGAGG - Intergenic
1189217563 X:39339661-39339683 CTCCTGAATCTCAGCATCTGAGG + Intergenic
1189481335 X:41394434-41394456 CTTCTGTGCCTGACCAACTCAGG - Intergenic
1189963331 X:46346063-46346085 CTTCTGTCTCTCACCAAATTTGG - Intergenic
1190336919 X:49268327-49268349 CTTTGGGGTCTCACCTTCTGTGG - Intergenic
1190784179 X:53628043-53628065 CTTCTGCGACTCAACCTCTGAGG + Intronic
1191099063 X:56705256-56705278 CTGCTCTGGCTCACCCTCTGTGG + Intergenic
1191133363 X:57038307-57038329 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
1193906832 X:87254211-87254233 CTGCTTTGGCTCACCTTCTGTGG + Intergenic
1196230239 X:113212512-113212534 CTGCTTTGGCTCACCCTCTGTGG + Intergenic
1196571201 X:117268207-117268229 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
1196996065 X:121385398-121385420 TTGCTGTGTCTCACATTCTGTGG + Intergenic
1197403665 X:126025426-126025448 CTGCTTTGGCTCACCCTCTGTGG - Intergenic
1198850675 X:140962717-140962739 CTCCTGTTTTTCACCATGTGGGG - Intergenic
1201366365 Y:13211209-13211231 CCTCTGTATCTCTCCAGCTGTGG + Intergenic