ID: 954943249

View in Genome Browser
Species Human (GRCh38)
Location 3:54394006-54394028
Sequence TTCTGTGTCTCACCATCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954943240_954943249 30 Left 954943240 3:54393953-54393975 CCATTTTGGGTACCTTGTTGCTG 0: 1
1: 0
2: 1
3: 11
4: 171
Right 954943249 3:54394006-54394028 TTCTGTGTCTCACCATCTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 194
954943245_954943249 -3 Left 954943245 3:54393986-54394008 CCATACAGGGTCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 954943249 3:54394006-54394028 TTCTGTGTCTCACCATCTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 194
954943241_954943249 18 Left 954943241 3:54393965-54393987 CCTTGTTGCTGCTGCATGTGTCC 0: 1
1: 0
2: 3
3: 8
4: 225
Right 954943249 3:54394006-54394028 TTCTGTGTCTCACCATCTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954943249 Original CRISPR TTCTGTGTCTCACCATCTGG GGG Intronic
900466068 1:2826067-2826089 TTCTGTGGCTCCCCCACTGGTGG + Intergenic
900682197 1:3923217-3923239 TTCTGAGTCACTCCATCTGTGGG + Intergenic
900887780 1:5427643-5427665 TTCTGTGTCTCAACAGCTTCTGG + Intergenic
900897857 1:5496315-5496337 CTCTGTGTCCCCCCAGCTGGAGG + Intergenic
900922447 1:5681971-5681993 CTCTGAGTCTCACCAGCTTGTGG + Intergenic
902755958 1:18549347-18549369 ATCTGTGTTTCTCCAGCTGGGGG - Intergenic
904635385 1:31876897-31876919 TTCTGTATCTCATTACCTGGAGG + Intergenic
906603758 1:47150711-47150733 TTATTTGTCTCATGATCTGGTGG + Intergenic
906961549 1:50422281-50422303 TTTTGTCTCTCACTCTCTGGAGG - Intronic
909696912 1:78477795-78477817 TTCATTGTCTCACAGTCTGGAGG + Intronic
910537740 1:88318489-88318511 TTCTTTTTCTCCCCATCTGTAGG - Intergenic
913491409 1:119383350-119383372 TTCTGGCTCACACCATCTGTAGG + Intronic
914458689 1:147861771-147861793 TTCTTTGGCTCACCCTCTGTGGG - Intergenic
916689521 1:167177107-167177129 TTCTGTGAATCACCTTCGGGGGG + Intergenic
917194495 1:172451022-172451044 TTCTGTTTCTCAGCATCTTGAGG - Intronic
918569443 1:185971161-185971183 TTCTAAGTATCAACATCTGGAGG + Intronic
919322144 1:196057091-196057113 TTCTGTGTCATAGCCTCTGGTGG - Intergenic
919700063 1:200622470-200622492 TTCTGTTTGTCTCCCTCTGGTGG - Intergenic
919715091 1:200768122-200768144 TTCAGTGTCTCACTTTCTAGCGG + Intronic
920924615 1:210329535-210329557 TTCTGAGTCTAACCTTCAGGTGG + Intronic
921297734 1:213720560-213720582 TTCTTTGGGTCACCATCTGTAGG - Intergenic
924147464 1:241090991-241091013 TTCTGTTTCTCACCACCTCATGG - Intronic
924180063 1:241431232-241431254 TGCTTTGGCTCACCCTCTGGGGG + Intergenic
1062950117 10:1492734-1492756 TTCTGAGTCTCACAATCAGAAGG + Intronic
1063442986 10:6088801-6088823 TTCTCCTCCTCACCATCTGGGGG + Intergenic
1067713113 10:48666121-48666143 TTCAGTGGCTAGCCATCTGGAGG + Intergenic
1067757022 10:49012829-49012851 GTCTGTCTCTCACCCTCTGCTGG - Intergenic
1068263368 10:54614259-54614281 TTTTGAGTTTCACCATCTGTTGG + Intronic
1070437961 10:76412100-76412122 TTGTTTGACTCACCAGCTGGAGG + Intronic
1070735265 10:78859650-78859672 TCCTGTGTCTCACCAGCTCGTGG + Intergenic
1072307569 10:94122053-94122075 TTCTGTGTGTCCCCAACAGGTGG - Intronic
1072428876 10:95353824-95353846 TCTTTTGTTTCACCATCTGGTGG + Intronic
1072636889 10:97184216-97184238 TTCTGTCTCTGACCAGCTGGGGG + Intronic
1072693916 10:97589407-97589429 TTCTCTCTCTCCCCATCTGGTGG - Intronic
1073500447 10:103932219-103932241 TTCTGGGTCTCATCTTCAGGAGG - Intergenic
1074017093 10:109545477-109545499 TGCTGTGGCTCACCCTCTGTGGG - Intergenic
1076482630 10:130794783-130794805 TTCAAGGTCTCTCCATCTGGCGG + Intergenic
1079243977 11:18739935-18739957 TTCTGGGTCTCAGTATCGGGAGG + Intronic
1079482447 11:20895612-20895634 TTCTCTGCCTCAGCCTCTGGAGG + Intronic
1080345953 11:31325412-31325434 TTTTATGACTCACCATTTGGAGG - Intronic
1082270883 11:50168434-50168456 TAATGTGTGTTACCATCTGGAGG + Intergenic
1087951195 11:104221860-104221882 TTCTGTCTCTCACCTACTGTTGG - Intergenic
1089940395 11:122410526-122410548 TTCTGTGTCTCACAGCCTTGGGG + Intergenic
1091388684 12:111825-111847 GTCTGTTTCTCACAACCTGGTGG - Intronic
1092926435 12:13276446-13276468 TTCTGTCCCACCCCATCTGGGGG - Intergenic
1094270982 12:28614087-28614109 TACTGTCTCTCAGCTTCTGGTGG + Intergenic
1094830434 12:34297697-34297719 GTCCGTGTCTCACCCACTGGGGG + Intergenic
1097439103 12:59587605-59587627 CTCTGGGTCTCACAATCTGGGGG - Intergenic
1097553046 12:61099407-61099429 TTCTGTGTCTTTCCATCAGTAGG - Intergenic
1099848737 12:88063773-88063795 TGCTGTTTCCCAGCATCTGGAGG + Intronic
1100583661 12:95959628-95959650 CTTTCTGTCTCACTATCTGGGGG - Intronic
1100825393 12:98470142-98470164 TCCTGAGTCTCACCATCTCCTGG - Intergenic
1103946459 12:124529681-124529703 TTATGTGTCTGGCCAGCTGGTGG - Intronic
1104302561 12:127578073-127578095 TTCTGTTTCTCACCACCTGACGG - Intergenic
1105750416 13:23418537-23418559 TGCTCTGTCTCTCCAGCTGGAGG + Intronic
1106531922 13:30601382-30601404 TTCTGTGTCTTACCTGTTGGGGG + Intronic
1107028505 13:35827317-35827339 TTGTGTGTCACACAAACTGGTGG + Intronic
1107374614 13:39788491-39788513 CTCTGTGACTCTTCATCTGGTGG + Intronic
1108114241 13:47110157-47110179 TTCTGAGTCTGAGCCTCTGGAGG + Intergenic
1108357560 13:49641493-49641515 TTCTGTGGCTCCACAGCTGGAGG - Intergenic
1113581490 13:111433278-111433300 TTCTGTGTCTTCCCACCTGATGG + Intergenic
1113790764 13:113026853-113026875 TTCTGTGTCTCCCCAGCGGCGGG + Intronic
1113795524 13:113055611-113055633 TTCTGTGTCTCAGCAAGGGGCGG - Intronic
1115476547 14:33819948-33819970 ATCTATGTCTCACCATTTGATGG - Intergenic
1115542081 14:34430402-34430424 TTCTGTGTCTCTCTCTCTGCAGG + Intronic
1117198201 14:53362156-53362178 TTCGGTGGCTAGCCATCTGGAGG - Intergenic
1120118157 14:80644121-80644143 TTCTTTGTCTCAGCTTTTGGTGG - Intronic
1124785885 15:32680142-32680164 TTCTGTGTCTCCCCTTCTTTGGG + Intronic
1125514644 15:40311208-40311230 ATCTGTGCCTCATCAGCTGGGGG - Intergenic
1126497348 15:49306824-49306846 TTTTGTGTCTCACTCTCTTGAGG - Intronic
1127137450 15:55939338-55939360 TTCTGTCTCCTACCATCTTGTGG + Intronic
1133087237 16:3374493-3374515 TTTTGTGTCTCACCATTTCTTGG - Intronic
1136070026 16:27782148-27782170 TCCTGTCTCTGCCCATCTGGGGG - Intergenic
1136488839 16:30591552-30591574 TTGTGCATCTCACCATCTGAGGG - Intergenic
1138116324 16:54363555-54363577 TTCTCTCTCTCACCAGCTGCTGG - Intergenic
1138773314 16:59690282-59690304 TTCTGAGTCTCTCTACCTGGTGG + Intergenic
1140066768 16:71617886-71617908 TGCTGTGTCTCCCAGTCTGGAGG + Intergenic
1140275106 16:73502032-73502054 TTCTGTTTCTCTCCACCAGGAGG + Intergenic
1141166263 16:81662844-81662866 TTCTGTGACTCTTCAACTGGTGG - Intronic
1143316433 17:6036780-6036802 TTCAGTGTATCTCCAGCTGGAGG - Intronic
1144307331 17:13980658-13980680 TTCTGTGTCTGACCATCTTCAGG - Intergenic
1147938036 17:44024766-44024788 TTCGGGGTCTCACCATTTGCTGG + Intergenic
1148765351 17:50035592-50035614 ATCTGCCTCTCACCATTTGGAGG + Intergenic
1149083877 17:52691129-52691151 TTCTGTGACTAACCATCAGCTGG + Intergenic
1152132603 17:78486127-78486149 TTCTGTGTCTCAACAGCTTGTGG - Exonic
1153224324 18:2886836-2886858 TGCTGTGTCTGAACATATGGAGG - Intronic
1156163406 18:34387216-34387238 TTCTCTGTCTTCCCATCTAGAGG + Intergenic
1157083832 18:44556557-44556579 CTCAGTGTCTCACCAGCTCGTGG + Intergenic
1158601605 18:58860672-58860694 TTCTTTATCTCACCATCCAGAGG - Intergenic
1158703659 18:59771498-59771520 TGCTTTGGCTCACCATCTGTGGG - Intergenic
1160115324 18:76073945-76073967 TTTTTTGTCTTTCCATCTGGAGG + Intergenic
1160926854 19:1550579-1550601 CTCTGTTGCTCACCAGCTGGTGG + Intergenic
1161747094 19:6067484-6067506 TTGTGTGTCCTGCCATCTGGGGG - Intronic
1162420425 19:10562974-10562996 TTGTGCTTGTCACCATCTGGTGG + Intronic
1163316237 19:16542341-16542363 GTTTGGGTCTCACCATCGGGGGG + Exonic
1164420565 19:28088186-28088208 TTCTGTGGCTCCACCTCTGGGGG + Intergenic
1167104382 19:47421550-47421572 GTCTGTCTCTCTCCTTCTGGGGG + Intergenic
1167335195 19:48880942-48880964 TTCTGTGCCTCCTCATTTGGAGG - Intergenic
927212279 2:20646208-20646230 GTCTGTGTCTCACCTTATGTAGG - Intronic
929950478 2:46406170-46406192 CTCTGTCTCTCAGCTTCTGGAGG - Intergenic
930815579 2:55593921-55593943 TTCTTTGTCTGATCATCTGTTGG - Intronic
930941675 2:57021840-57021862 TTCTTTGGCTCACCCTCTGTGGG - Intergenic
931049266 2:58392461-58392483 TTCAATGTTTCACAATCTGGTGG + Intergenic
932456059 2:71850767-71850789 TTCTGTATCATATCATCTGGGGG - Intergenic
933422081 2:82061698-82061720 TTCTGTGACTCCACATATGGGGG + Intergenic
936871435 2:117137739-117137761 ATTTGTGTCTCACAATCTGTAGG - Intergenic
937264328 2:120606603-120606625 TTCTGTGTATCCCGTTCTGGTGG - Intergenic
937432455 2:121850740-121850762 TTCTGTCTCCCTCCATCTGCAGG - Intergenic
937959953 2:127450010-127450032 TTCTCTGTCTCTCCATTTTGAGG + Intronic
938470685 2:131557434-131557456 TTCTGGATCTCATCCTCTGGGGG + Intergenic
938981087 2:136527835-136527857 ATGTGTGTGTCCCCATCTGGAGG + Intergenic
939623028 2:144444474-144444496 CTCTGTGTGTCACCAGCTGGGGG + Intronic
940079066 2:149779619-149779641 TTCTGATTCTCACCGACTGGTGG + Intergenic
942075499 2:172353555-172353577 TTATGAGTTTCCCCATCTGGTGG + Intergenic
942700404 2:178701515-178701537 TTCTGGGTCTTACCTTCTGGTGG + Exonic
945045257 2:205776227-205776249 TTCTGTGTCTCTCCACCAGGGGG + Intronic
948001763 2:234573594-234573616 TCCTGTGTCTCACCACGAGGAGG - Intergenic
948280718 2:236745983-236746005 TTCTGTGTCTCACGCCCTGGGGG - Intergenic
948846651 2:240686092-240686114 GGCTGTGTGTCAGCATCTGGAGG + Intergenic
1169300735 20:4440022-4440044 TTCTGTTACTCATCTTCTGGGGG - Intergenic
1170727533 20:18943195-18943217 TTCTGGGTCTCACCACCCAGTGG + Intergenic
1172426875 20:34861557-34861579 TTCTGTGTCTCTCCCAGTGGGGG - Exonic
1172863521 20:38076795-38076817 TTCTGTGTACCACCCTCTGCTGG + Intronic
1174560167 20:51425492-51425514 CCCTGTGTCTCACCCTCTGTCGG + Intronic
1175071348 20:56336611-56336633 TGCTTTGACTCACCATCTGTGGG - Intergenic
1177263139 21:18754016-18754038 TTCAGTGGCTAGCCATCTGGAGG + Intergenic
1177661276 21:24086352-24086374 TTCTGGGTCTAGCCACCTGGTGG - Intergenic
1179927871 21:44548168-44548190 GTCTGTTTCTACCCATCTGGTGG - Intronic
1181951723 22:26558630-26558652 CTCTCTGTCTCCCCATCTGACGG - Intronic
1182669097 22:31980846-31980868 TTCTGTGCCTCAGCGCCTGGTGG + Intergenic
949284630 3:2386948-2386970 CTCTGTTTCTCTCCATCTGTTGG + Intronic
953666039 3:44927385-44927407 TTGTGTGTCTCACCAGCCTGGGG + Intronic
954943249 3:54394006-54394028 TTCTGTGTCTCACCATCTGGGGG + Intronic
956284588 3:67595400-67595422 TTCTGTGTCTTCCCTTCTTGGGG - Intronic
957625666 3:82649993-82650015 TTCTGTTCCTCACCATAAGGGGG + Intergenic
958768226 3:98396083-98396105 TTCTGGGTCTAACCACCCGGTGG - Intergenic
958858583 3:99417613-99417635 TTCTGTCTGTCACCAGCTGATGG + Intergenic
961804850 3:129482061-129482083 GTCTGTGTCTCACCTGCTGCAGG + Intronic
962140040 3:132780631-132780653 TTCTCAGGCTCAGCATCTGGAGG - Intergenic
962210100 3:133470751-133470773 TTCCAAGTCTCACCATCTGGTGG + Intronic
963299387 3:143581854-143581876 TTCTGAGTCTCACCTGCTGGTGG - Intronic
964475164 3:157091401-157091423 TTCTGTCACTCACCCTGTGGTGG - Intergenic
965678402 3:171224155-171224177 TTTTGTCTCTCTCCATCTGTGGG - Intronic
967320800 3:188193010-188193032 TTCTTTCTATCACCATCAGGAGG - Intronic
967525087 3:190483170-190483192 TACTGTGCCTAACCATCTAGAGG + Intergenic
967789412 3:193531189-193531211 TTCTATGTCTCAATATCTGGTGG - Intronic
968442575 4:631583-631605 ATCTGTGTGGCACCATCTGAGGG + Intronic
968443584 4:636758-636780 GTCTTTATCTCAGCATCTGGAGG + Intronic
970765439 4:19543047-19543069 TTTTGTGTCTCAGCATTTTGAGG + Intergenic
970804740 4:20017648-20017670 TTCTCTGTCTCATCATTTGGAGG + Intergenic
971005344 4:22368221-22368243 TTCTATGTCTGACTTTCTGGCGG - Intronic
971319354 4:25592802-25592824 TGTTGTGTCTGTCCATCTGGGGG - Intergenic
978605440 4:110474692-110474714 CAATGTGTGTCACCATCTGGAGG + Intronic
978652310 4:111020593-111020615 TTCTATGTGTCATCATCTGAGGG + Intergenic
980860992 4:138499620-138499642 TTCTGGGTCTAGCCATCTAGTGG + Intergenic
983399242 4:167242972-167242994 GTCTGTGTCTCACCATATTTGGG + Intergenic
984142892 4:176024561-176024583 TTCTGTGTTTCCTCATCTTGTGG - Intergenic
984270977 4:177548409-177548431 TTGTGTATCTCTTCATCTGGCGG + Intergenic
984882468 4:184422380-184422402 TTCTGTGTTTCACTTTCTTGAGG - Intronic
985607092 5:863607-863629 TGCTGTGTCCTACCAGCTGGTGG - Intronic
986107103 5:4670470-4670492 GTCTGTTTCTCACAATGTGGTGG + Intergenic
987275316 5:16355876-16355898 TTCTTTGGCTCACAATCTAGTGG - Intergenic
987642837 5:20633872-20633894 CACTGAATCTCACCATCTGGGGG + Intergenic
989150280 5:38292140-38292162 TTCTGTTTCTGCACATCTGGGGG - Intronic
989805234 5:45595770-45595792 TTCTGTGTCTCAGTATCTTGTGG + Intronic
990824463 5:59882033-59882055 TTCTGTTTCTCACAAACTGTGGG + Intronic
992363139 5:76063258-76063280 TTTTGTGTCCCACCTTCTAGAGG + Intergenic
994297220 5:98105032-98105054 TTCTGTGTTTGAACATCTGAAGG - Intergenic
996012082 5:118492377-118492399 ATCTGTGTCTCACTAACTTGAGG - Intergenic
997014423 5:129915681-129915703 TTCTGTGTCTCAAAAAGTGGTGG + Intronic
999672662 5:153971409-153971431 TTCTTTCTCTCACCACCTCGAGG - Intergenic
1002505975 5:179679364-179679386 GGCTGTGTCTCACCAGCTGCTGG + Intronic
1003761066 6:9179541-9179563 TGCTGTGTATCACGAACTGGGGG - Intergenic
1003982914 6:11406280-11406302 TTCTGAGGCTCACCCTCTGCAGG - Intergenic
1007092018 6:39190550-39190572 GTCTTTGTCTCACCATTTGGTGG - Exonic
1010911835 6:81567795-81567817 TTCTGTGCCTGACCCTCAGGAGG - Intronic
1011337014 6:86272497-86272519 TTCTTTGTCTCACCCTCCGTGGG + Intergenic
1013169192 6:107620785-107620807 TTCTGTGTCTCACCAGATCCAGG + Intronic
1018557745 6:165065857-165065879 GTTTGTTTCTCACAATCTGGGGG - Intergenic
1019504262 7:1382934-1382956 TTCTGTGTTTCTGCATCTCGTGG - Intergenic
1021309307 7:19073617-19073639 TTCTTGGGCTCACTATCTGGAGG + Intronic
1026846499 7:73701709-73701731 GTCTGTTTCTCACCAGATGGCGG + Intronic
1028364296 7:90009490-90009512 TTCTGTGTTACACAATCTTGAGG + Intergenic
1031261439 7:119525567-119525589 TTCTGTGTCTAACCACCCAGTGG - Intergenic
1032946345 7:136857447-136857469 TTCTGTGTCTCCGCATGTGCTGG - Intergenic
1033503091 7:141973498-141973520 TGCTGTGTCTCAGCATCAGCCGG - Exonic
1033625255 7:143104818-143104840 TTCAGTTTTTCAGCATCTGGTGG - Intergenic
1034480377 7:151315224-151315246 TTCTGAGTCTCACCACCAGAGGG + Intergenic
1035459615 7:159030908-159030930 TTCTGTTTCTGTCCATCTGCTGG - Intronic
1038782987 8:30584224-30584246 TTCTTTCTCTCACTTTCTGGCGG + Intronic
1040064079 8:43130193-43130215 TTCTGTGTTTCCTCATCTGTAGG + Intergenic
1044092181 8:88015486-88015508 TTTTGTGTCTCACAATCAGATGG - Intergenic
1045673717 8:104586705-104586727 TTCTGTCTCTAACCATATGTGGG - Intronic
1046277723 8:111985427-111985449 TTCTTTGGCTCACCCTCTGTGGG - Intergenic
1046552632 8:115735572-115735594 TTCTGTGTCCCAGAATATGGTGG - Intronic
1047165415 8:122432830-122432852 TTCTGTCTCTCTCTACCTGGAGG - Intergenic
1050291347 9:4158541-4158563 TTCTGTATCTCAGCATATCGGGG - Intronic
1051929531 9:22367837-22367859 TTCTGGGTCTAGCCATCTAGTGG - Intergenic
1053302356 9:36961009-36961031 ATCTGTGTCCCACCATGAGGAGG - Intronic
1056057119 9:82837316-82837338 TTCTGGGTCTCTCTATCTAGTGG + Intergenic
1057552370 9:96061351-96061373 TTCTCTGTCTCCCAGTCTGGAGG - Intergenic
1061127236 9:128684621-128684643 TTCTGAGACTCCCCACCTGGAGG + Intronic
1190903028 X:54697379-54697401 TTCTGTGTCATCCAATCTGGTGG - Intergenic
1193746009 X:85282240-85282262 GTCTGTGTTTCACTACCTGGTGG + Exonic
1195029764 X:100914947-100914969 TCCTCTGCATCACCATCTGGCGG - Exonic
1195298426 X:103502902-103502924 TTCTGTGTCTCAGCATTTAAAGG - Intronic
1195301695 X:103536138-103536160 TTCTGTGTCTCAGCATTTAAAGG - Intergenic
1195301966 X:103538760-103538782 TTCTGTGTCTCAGCATTTAAAGG - Intergenic
1199988996 X:152973837-152973859 TTCTGTATGTCACCCACTGGTGG + Intergenic
1200461045 Y:3454526-3454548 TTCTGTGTAGCTCCAACTGGAGG + Intergenic
1200924602 Y:8643186-8643208 TTTAGTCTCTCACCATTTGGTGG + Intergenic
1201763356 Y:17560609-17560631 TTGTGTGTCTCGCCCTCAGGGGG + Intergenic
1201838197 Y:18345381-18345403 TTGTGTGTCTCGCCCTCAGGGGG - Intergenic