ID: 954943250

View in Genome Browser
Species Human (GRCh38)
Location 3:54394018-54394040
Sequence GGTAACTCTGGACCCCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954943250_954943257 7 Left 954943250 3:54394018-54394040 CCATCTGGGGGTCCAGAGTTACC 0: 1
1: 0
2: 1
3: 12
4: 128
Right 954943257 3:54394048-54394070 GGTAGGCATCTCATTCACTGGGG 0: 1
1: 0
2: 0
3: 5
4: 124
954943250_954943253 -10 Left 954943250 3:54394018-54394040 CCATCTGGGGGTCCAGAGTTACC 0: 1
1: 0
2: 1
3: 12
4: 128
Right 954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 91
954943250_954943256 6 Left 954943250 3:54394018-54394040 CCATCTGGGGGTCCAGAGTTACC 0: 1
1: 0
2: 1
3: 12
4: 128
Right 954943256 3:54394047-54394069 AGGTAGGCATCTCATTCACTGGG 0: 1
1: 0
2: 0
3: 7
4: 112
954943250_954943255 5 Left 954943250 3:54394018-54394040 CCATCTGGGGGTCCAGAGTTACC 0: 1
1: 0
2: 1
3: 12
4: 128
Right 954943255 3:54394046-54394068 GAGGTAGGCATCTCATTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954943250 Original CRISPR GGTAACTCTGGACCCCCAGA TGG (reversed) Intronic
901847115 1:11990476-11990498 GGTTAGTCTGGGCTCCCAGAGGG - Intronic
903350131 1:22711859-22711881 GGTACCACTCGACCCCCAGGGGG + Intronic
903537274 1:24075344-24075366 GGGCCCACTGGACCCCCAGAGGG - Exonic
904945664 1:34197065-34197087 AGACACACTGGACCCCCAGAGGG - Intronic
906128777 1:43443451-43443473 GAGACCTCTGGACCCCCTGACGG + Exonic
908216048 1:61953473-61953495 GGTAGTTCAGGACCCCCACAGGG - Intronic
910488931 1:87746572-87746594 GTGACCTCTGGAGCCCCAGAGGG - Intergenic
916547204 1:165817152-165817174 GGTACCTCTGTAAACCCAGAGGG - Intronic
917187963 1:172382894-172382916 AGTAAATGTGGACCTCCAGAGGG - Intronic
924490745 1:244535362-244535384 GGTACCTCTGGACCCACATGGGG - Intronic
1062884172 10:1004170-1004192 GGGAACTCTGGACCCTGGGATGG + Intronic
1065078127 10:22101482-22101504 AATAACTCTGGACCCCCACAAGG - Intergenic
1067210644 10:44258167-44258189 GGTACCCCTGGGCCTCCAGAGGG + Intergenic
1068015238 10:51507638-51507660 GGTCACTCATGACCCGCAGAAGG - Intronic
1074710083 10:116169906-116169928 GCAACCTCTGGAGCCCCAGAGGG - Intronic
1077036087 11:495156-495178 GGCAACTCAGGACCCTCAGGTGG + Intronic
1081591924 11:44429395-44429417 GCTAAATTTGGACCCCAAGATGG + Intergenic
1083300447 11:61737330-61737352 GCCAACTCTGAAGCCCCAGATGG - Intronic
1084119218 11:67059195-67059217 GGGAACTCAGAGCCCCCAGACGG - Intronic
1087602905 11:100338938-100338960 TGTAACCCTGGAACCCCAGAGGG + Intronic
1089053684 11:115567000-115567022 GGTAACCCTCATCCCCCAGATGG - Intergenic
1092042024 12:5393577-5393599 GGAACCTCTGGACCACCAGCTGG + Intergenic
1094610553 12:31991332-31991354 AGTAACACTGAAGCCCCAGATGG - Intronic
1096880651 12:54666287-54666309 GGTAACTCTGGGCCTTCAGATGG + Intergenic
1100919149 12:99462801-99462823 GGTAACTCATGACCTCCACAGGG - Intronic
1102046989 12:109835587-109835609 GTTTACTCCGGACCCTCAGAGGG - Intergenic
1103937349 12:124483574-124483596 GGTAAGCCTGGGCCCCCAGCTGG - Exonic
1103976033 12:124703344-124703366 AGGAACTGTGGACTCCCAGAAGG + Intergenic
1108691436 13:52862635-52862657 TGTAAATCTTGACCCCAAGATGG - Intergenic
1110196542 13:72794957-72794979 GGTAACACTGAACCACCATAAGG - Intronic
1111783919 13:92763929-92763951 AGTGACTCTGGCCCCTCAGATGG + Intronic
1112446104 13:99465607-99465629 GGCCACTCTGGAACCCCAGTGGG + Intergenic
1115944497 14:38644220-38644242 GGTAACTCTGAAACCCAGGAGGG - Intergenic
1116434125 14:44877625-44877647 GGCATCTCTGGACCCCCGCAGGG + Intergenic
1116708276 14:48331627-48331649 TGTATTTCTGGACTCCCAGATGG + Intergenic
1118173841 14:63417930-63417952 GGTATCTGTGGACCCTTAGAGGG - Intronic
1120474443 14:84969654-84969676 GCGAACCCTGGAGCCCCAGAGGG + Intergenic
1127984063 15:64055033-64055055 GGTAACTCTGGTCCTCCATGAGG + Intronic
1128693662 15:69744440-69744462 TGTAGGTCTGGGCCCCCAGAGGG + Intergenic
1129644772 15:77419932-77419954 GGCAACCCTGGTCCCACAGACGG + Intronic
1132543217 16:521107-521129 GGAAGCTCTGGGCCCCCGGAAGG - Exonic
1132993679 16:2811568-2811590 AGTGACTCTGAACCCCGAGAAGG + Intergenic
1133271223 16:4611724-4611746 GGGAACTGAGGAGCCCCAGAGGG + Intronic
1136510573 16:30736052-30736074 GGTAACTCTGGAGGCCTAGGAGG + Intronic
1137577835 16:49615398-49615420 GGTAAATCTGGACACCTAGAGGG + Intronic
1145791931 17:27632788-27632810 GGGTACTCTGGACACCCATAGGG - Intronic
1146644511 17:34568196-34568218 GGGAACTCTGGAGTCCCAGGTGG + Intergenic
1152196293 17:78920341-78920363 CGTGGCTCTGCACCCCCAGAAGG + Intronic
1158409257 18:57190177-57190199 GGTCAGGCTGGACCTCCAGATGG + Intergenic
1160089879 18:75816734-75816756 GGGAACTTTGGACCCAGAGATGG - Intergenic
1160477342 18:79203770-79203792 GGAACCTCTAGACCCCCAGCAGG + Intronic
1161770863 19:6230068-6230090 GGGAACTCTGAGCCCCCACAGGG + Intronic
926045632 2:9707817-9707839 GGTCACTCTGGCCACCCGGAGGG + Intergenic
927098249 2:19764437-19764459 GCTAAGACTGGAGCCCCAGATGG + Intergenic
931161875 2:59701958-59701980 GGTACCTCTGGACCCACCTAGGG - Intergenic
936824442 2:116563985-116564007 GGTACCTCAGGACCCACAGAGGG - Intergenic
937617675 2:123944819-123944841 GGTACTTCTGGACTCACAGAGGG + Intergenic
939172845 2:138715746-138715768 GGTGACTCTAGACCTCTAGAGGG - Intronic
941096036 2:161239598-161239620 GGGAACTCTCGAGGCCCAGACGG - Intergenic
943475860 2:188354204-188354226 GGTGACTCTGGACTCTGAGATGG - Intronic
944601528 2:201308385-201308407 GGGCACTCTGGACTGCCAGAAGG - Intronic
944707540 2:202306294-202306316 GGTAATTGAGGAGCCCCAGAGGG + Intergenic
947945966 2:234102579-234102601 GGTAACTCTGGACAGCAACAGGG - Intergenic
948471813 2:238186922-238186944 GGGACCTCTGGAGCCCAAGAAGG - Intronic
1173557103 20:43973978-43974000 GGCAACTATGACCCCCCAGAGGG - Intronic
1175925408 20:62468894-62468916 GGTCACCCAGGGCCCCCAGATGG + Intronic
1177496513 21:21898930-21898952 GTTAACACTGGACTCCCATAGGG + Intergenic
1179124254 21:38577472-38577494 AGTAACTCTCATCCCCCAGAGGG - Intronic
1181397608 22:22633058-22633080 GTTCATTCTGGGCCCCCAGAGGG - Intergenic
1181500356 22:23312428-23312450 GTTCATTCTGGGCCCCCAGAGGG - Intronic
1181651798 22:24263000-24263022 GTTCATTCTGGGCCCCCAGAGGG + Intergenic
1181705578 22:24647739-24647761 GTTCATTCTGGGCCCCCAGAGGG - Intergenic
1183828448 22:40405750-40405772 GGTCAGTCTGGACACCCAGCAGG - Exonic
949131226 3:503412-503434 GTTAACTGAGGACTCCCAGAAGG + Intergenic
952530830 3:34260125-34260147 TGTAACCCTGGACCTCTAGAGGG - Intergenic
952561806 3:34603857-34603879 GCAAACCCTGGAGCCCCAGAGGG - Intergenic
954943250 3:54394018-54394040 GGTAACTCTGGACCCCCAGATGG - Intronic
960541118 3:118863971-118863993 GGTACCTCTGGACCCACCCAGGG - Intergenic
968835956 4:2964176-2964198 GGGAACCCTGGCCCCCCTGAAGG + Intronic
971959781 4:33471077-33471099 TGTGACCCTGGAACCCCAGAGGG + Intergenic
973264309 4:48196003-48196025 GGTATCTCTGTACCACCAGAAGG - Intronic
977721466 4:100244453-100244475 GTGACCTCTGGAGCCCCAGAGGG + Intergenic
977738191 4:100443972-100443994 GGTGACTCTGGACCCTGGGATGG + Intronic
979728440 4:123992470-123992492 GGGACCCCTGGAACCCCAGAGGG - Intergenic
979846762 4:125523141-125523163 GCAACCTCTGGAGCCCCAGAGGG - Intergenic
979938503 4:126728050-126728072 GCTAATTCTGGAACCCCAGCAGG - Intergenic
980448203 4:132938946-132938968 GGTGACTCTAGACCCTTAGATGG - Intergenic
981600370 4:146481462-146481484 GGTGACTCTGGACCCCGAAATGG - Intronic
982050641 4:151498327-151498349 CCTAACACTGGAACCCCAGAAGG - Intronic
982773699 4:159421037-159421059 GGGCACTCTGGCACCCCAGAGGG - Intergenic
982869113 4:160553526-160553548 GTGACCTCTGGAGCCCCAGAGGG + Intergenic
984382926 4:179017938-179017960 GGGACCCCTGGAGCCCCAGAGGG - Intergenic
986007302 5:3678494-3678516 TGTAACTGTGGACCACTAGAGGG + Intergenic
986030515 5:3888942-3888964 GCTGGCTCTGGGCCCCCAGATGG - Intergenic
987402308 5:17491206-17491228 GCTACCTTTGGACCCCCGGAGGG + Intergenic
990463187 5:56048196-56048218 GGGACCTCTGGAGCCCCAGAAGG - Intergenic
991156834 5:63447052-63447074 GGTAACTCTGTACCCTTTGAGGG - Intergenic
994913454 5:105943438-105943460 TGTGACCCTGGAACCCCAGAGGG + Intergenic
995040076 5:107577662-107577684 GTAAACTCTGGACCCCCAGAAGG + Intronic
996242094 5:121216108-121216130 GCAACCTCTGGAGCCCCAGAGGG - Intergenic
999264488 5:150257454-150257476 GGAAACTCTGGACCACAAGAGGG + Intronic
1002679512 5:180949908-180949930 GGTGACTCTGGATCCAGAGACGG + Exonic
1002685380 5:181005338-181005360 GGTGACTCTGGATCCAGAGACGG + Exonic
1002868490 6:1145454-1145476 TGCATTTCTGGACCCCCAGAAGG + Intergenic
1003499879 6:6695327-6695349 GGAAACACTGGACACACAGAGGG + Intergenic
1006003655 6:30986357-30986379 GGTCACGCTGGACCCTGAGATGG - Exonic
1009651310 6:66480724-66480746 GGAAACACTGGACAACCAGAGGG - Intergenic
1010621764 6:78085484-78085506 GTGACCTCTGGAGCCCCAGAGGG + Intergenic
1010650746 6:78452924-78452946 GGTTACTCTGGAGCCTCTGAGGG - Intergenic
1013039294 6:106417847-106417869 TGCAACTCTGAAGCCCCAGAAGG + Intergenic
1021203438 7:17752509-17752531 GGCACCTCTGGACCCACATAGGG - Intergenic
1024284343 7:47744402-47744424 GGGAGCCCTGGACGCCCAGAGGG + Intronic
1024561466 7:50648671-50648693 GGAAACTCTGGAAGCCCAGAGGG - Intronic
1026036285 7:66832687-66832709 GGTAACTGAGGCCCCCCAGAGGG + Intergenic
1026983205 7:74538451-74538473 GGTGACTGAGGCCCCCCAGAGGG - Intronic
1030942384 7:115669752-115669774 TGTAGCTTTGGACCACCAGATGG + Intergenic
1033309270 7:140248360-140248382 TGTAACCCTGGACTCCCAGGTGG + Intergenic
1034690268 7:153008242-153008264 GGTAAATCTGTAGCCCAAGATGG - Intergenic
1035050352 7:155995275-155995297 TGTAACACTGGAGCCCCAGCGGG + Intergenic
1035824363 8:2628844-2628866 GGGACCTATGGAGCCCCAGACGG + Intergenic
1037702318 8:21286282-21286304 GGTCATACTGGACCCCCACATGG - Intergenic
1038432508 8:27511503-27511525 GGTCACACTGGACACCCAGCTGG + Intronic
1039897307 8:41725468-41725490 GGTCACCCTGGAACCCCAGGAGG - Intronic
1040095771 8:43440853-43440875 GGCAACTCTGGACCCACATGGGG + Intergenic
1040422240 8:47251547-47251569 GGTCACTCTGGACCCTGGGATGG + Intergenic
1045216265 8:100151349-100151371 GCTAACAATGGACACCCAGAAGG + Exonic
1045317566 8:101056560-101056582 AGTAACTATGGCTCCCCAGATGG + Intergenic
1045902978 8:107307309-107307331 GGTAAATCCCAACCCCCAGATGG + Intronic
1048577060 8:135701222-135701244 GGTGACTCTAGACCCTGAGATGG + Intergenic
1048703030 8:137115826-137115848 GGGAACTCTGGCAGCCCAGAGGG + Intergenic
1050093903 9:2043831-2043853 AGAAACTCTGGCCCTCCAGAAGG - Intronic
1052158560 9:25226404-25226426 AGTAACTCTGGAGTCCCAAAGGG + Intergenic
1053330071 9:37197227-37197249 ATAAACTCTGGAGCCCCAGATGG + Intronic
1059573760 9:115468309-115468331 GGGACCCCTGGAACCCCAGAGGG + Intergenic
1186341547 X:8651124-8651146 GGGAACTCTGGAGCCGCTGAGGG + Intronic
1186685701 X:11922632-11922654 CGGACCTCTGGAACCCCAGAAGG + Intergenic
1187621621 X:21062637-21062659 GGTAACTCTGGACCCTAAAAGGG + Intergenic
1188526538 X:31093866-31093888 GTGACCTCTGGAGCCCCAGAGGG + Intergenic
1190892994 X:54587129-54587151 GCTGACTCTTGACCTCCAGATGG - Intergenic
1195220112 X:102738524-102738546 GTTAAGTCTGGAACCCAAGAAGG - Intronic
1195688576 X:107605821-107605843 GGTAACTCTGAAGAGCCAGAAGG - Intergenic
1199217859 X:145281916-145281938 GGTACCTCTGGACCCACCCAGGG - Intergenic