ID: 954943251

View in Genome Browser
Species Human (GRCh38)
Location 3:54394027-54394049
Sequence GGTCCAGAGTTACCACTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 5, 3: 12, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954943245_954943251 18 Left 954943245 3:54393986-54394008 CCATACAGGGTCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 954943251 3:54394027-54394049 GGTCCAGAGTTACCACTATGAGG 0: 1
1: 0
2: 5
3: 12
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954943251 Original CRISPR GGTCCAGAGTTACCACTATG AGG Intronic
900405100 1:2489529-2489551 GAGCCAGAGTGACCACCATGGGG - Intronic
901906683 1:12418351-12418373 GGATCTGTGTTACCACTATGAGG - Intronic
906621791 1:47287055-47287077 GGTCCAGATTTAAAACTATAAGG + Intronic
912740882 1:112196155-112196177 GCTCCAGTGTTATCACTGTGAGG - Intergenic
918225991 1:182484005-182484027 GGTCTAGAGTCACCACTACACGG - Intronic
918656139 1:187028206-187028228 AGTCCACAATGACCACTATGTGG + Intergenic
920268856 1:204747699-204747721 GGTTCAGAATTACCACTTGGAGG - Intergenic
1064617978 10:17182351-17182373 AGTCCAGAGTTACAACTTTTAGG + Intronic
1065951133 10:30652141-30652163 GTTCCAGTGATACCACTGTGGGG + Intergenic
1067288058 10:44921812-44921834 GGGCCAGAGCTACCACTCTCAGG + Intronic
1068363565 10:56012936-56012958 GGTCCAGAGTCACCACCACATGG + Intergenic
1072265552 10:93723438-93723460 AGTGCAGATTTAGCACTATGAGG - Intergenic
1075426671 10:122347114-122347136 GGTCCTGAGTTACCACTGAGGGG + Intergenic
1080713041 11:34769695-34769717 GGTCTAGAGTCACTACTATATGG - Intergenic
1081754446 11:45534662-45534684 GGCCCAGAGCTACCACTTGGAGG - Intergenic
1083094229 11:60233229-60233251 GGTCTAGAGTTAACACTATGTGG + Intronic
1083099550 11:60288642-60288664 TGTCTAGAGTTACCACTATGTGG - Intronic
1083202964 11:61131451-61131473 AGTGCAGAGTTATCTCTATGAGG - Exonic
1091812249 12:3409390-3409412 GGTCTAGAGACACCACTACGTGG - Intronic
1095631090 12:44378374-44378396 TGTCCAGAGTTTACACAATGTGG + Intronic
1096260292 12:50085777-50085799 GGTCCAGGGATACCTGTATGAGG + Intronic
1098613111 12:72485991-72486013 GGTCTACAGTCACCACTGTGTGG + Intronic
1101798468 12:108000222-108000244 GGTATAGAGTTACTACTATGCGG - Intergenic
1109837337 13:67877295-67877317 GGTCCAGAGTCACGACTGGGTGG - Intergenic
1110160378 13:72370278-72370300 CGTCCAGTAATACCACTATGTGG - Intergenic
1110556657 13:76867543-76867565 GGTACAAAGTTACCAGTAGGAGG + Intergenic
1110886647 13:80645872-80645894 GGTCCAGAATTTCCACTACTGGG - Intergenic
1118512905 14:66495699-66495721 GTTCCTGAATTACCACTCTGTGG - Intergenic
1129533932 15:76295227-76295249 TGTCCAGATTTACCACTTTCAGG + Intronic
1137359148 16:47797365-47797387 GGTCCAGAGCCACCACTATGTGG - Intergenic
1152995524 18:402807-402829 TGGCCTGAGTTACCACTTTGGGG + Intronic
1153410121 18:4783323-4783345 GGTATAGAGTCACCACCATGTGG + Intergenic
1154378494 18:13828544-13828566 GGTCCCGTGTAACCACCATGGGG + Intergenic
1159064048 18:63549827-63549849 TGTCCTGAGTGACCACCATGTGG - Intergenic
1162515083 19:11142822-11142844 GGTCCAGGGTCCCCTCTATGGGG - Intronic
928114238 2:28535476-28535498 TGGCCAGAGGTACCACTAGGAGG - Intronic
933390951 2:81666204-81666226 GGCCCAGAGTAACCAATATCTGG + Intergenic
933523794 2:83410146-83410168 GGTCCACAGTAACCACTGTCTGG + Intergenic
937878969 2:126850857-126850879 GCTCCAGAGCTAAGACTATGAGG + Intergenic
941354182 2:164468414-164468436 GCTCCAGTGTTACAACTATAAGG + Intergenic
946550009 2:220791147-220791169 GGTCCAGAATTACCTTGATGGGG - Intergenic
1171286817 20:23946426-23946448 GGCCCAGAGTGACCACAATGTGG + Intergenic
1174254809 20:49246655-49246677 GACCCAGAGATACCACTAGGTGG + Exonic
1175265600 20:57701600-57701622 GCTCCAAAGTTTCCACTATTGGG - Intronic
1175467170 20:59197240-59197262 TGTCCAGAGCTAACATTATGGGG + Intronic
1181484038 22:23219388-23219410 GCTCCAGAGTCATCCCTATGTGG + Intronic
1182310894 22:29405693-29405715 TGCCCAGAGTTACCACAGTGAGG - Intronic
1182468489 22:30532626-30532648 GGTCCAGGCTTCCCACAATGTGG + Exonic
1182690159 22:32155065-32155087 TGCCCAGAGTTACCACAGTGAGG + Intronic
954943251 3:54394027-54394049 GGTCCAGAGTTACCACTATGAGG + Intronic
963789025 3:149564273-149564295 GGTCCAGATCTACCACTAGCTGG - Intronic
966656787 3:182367624-182367646 AGTCCAGTGTGACCACTTTGTGG + Intergenic
970055276 4:11964723-11964745 GGTCCACATTTACAACTTTGTGG - Intergenic
971048477 4:22832144-22832166 AGTCCAGAGTCACCACTACATGG + Intergenic
971729513 4:30359894-30359916 GGTCCACTGTTAGCCCTATGGGG + Intergenic
972021712 4:34323755-34323777 GGTCCAGTGTAATCACTATTTGG - Intergenic
972736601 4:41848133-41848155 GGTCCTGAGTTACCACTTGGAGG - Intergenic
973678165 4:53286905-53286927 AGTCCAGAGTCACCACTATGTGG + Intronic
975448723 4:74500039-74500061 GGACCAGAGTCAACACTGTGTGG - Intergenic
978008583 4:103651181-103651203 GGTCCAGAGTTCCTCCTAGGTGG + Intronic
981232857 4:142378821-142378843 TGTCCAGAGTTTCCAACATGAGG + Intronic
981956567 4:150481352-150481374 GATCCAGAGTTCCCACTACTGGG - Intronic
994517872 5:100793842-100793864 GGTCCAGAGTTGCCTCTGGGTGG - Intergenic
995557634 5:113345427-113345449 GGCCCACTGTAACCACTATGTGG - Intronic
997415277 5:133723420-133723442 GGCCCAGAGTCACCACTGTGTGG - Intergenic
998046355 5:138990242-138990264 GCACCAGTGTGACCACTATGAGG + Intronic
998316778 5:141189553-141189575 GTTCCAGAGCTACCAGTACGAGG + Exonic
998317411 5:141194793-141194815 GTCCCAGAGCTACCAGTATGAGG + Exonic
998319040 5:141211142-141211164 GTCCCAGAGCTACCACTATGAGG + Exonic
1007386443 6:41523352-41523374 GGTCCAGAGGGACCCCTCTGGGG + Intergenic
1020372972 7:7454689-7454711 GGTGCTGAGTGACCACTATGGGG - Intronic
1021556218 7:21921184-21921206 GCTCCAGAGGTACCATTAGGGGG + Intronic
1021657966 7:22890543-22890565 GGGCCACAGTTGCCACTAAGTGG - Intergenic
1022967606 7:35487939-35487961 GTTCCAGTGTTGCAACTATGGGG + Intergenic
1025141932 7:56474006-56474028 TGTCCAGACTTAGAACTATGGGG + Intergenic
1025976654 7:66376292-66376314 GGCCTTGAGTGACCACTATGAGG + Intronic
1026129219 7:67606528-67606550 GGTCCAGAGTTTCCTTCATGAGG + Intergenic
1027910877 7:84248838-84248860 AGCCCAGCGTTCCCACTATGAGG + Intronic
1028759209 7:94476280-94476302 GGTCCACAGGTACCACTTTGAGG - Intergenic
1029015762 7:97314137-97314159 GGCCCAAAGTTCCCACTCTGGGG - Intergenic
1030501275 7:110363362-110363384 TGTCCAGAGTCACCACTGTGTGG - Intergenic
1031158477 7:118138272-118138294 GATCCAGAAATCCCACTATGGGG + Intergenic
1031308549 7:120164447-120164469 CCTTCAGAGTTAGCACTATGTGG + Intergenic
1040422237 8:47251538-47251560 GGTCCAGAGTGACCACTGTTTGG - Intergenic
1047413313 8:124642075-124642097 GTTCCAGAATAACCACCATGTGG + Intronic
1049287067 8:141781620-141781642 GGCCCAGAGTTTCCAGTCTGAGG + Intergenic
1050389462 9:5123664-5123686 GATCCAGCATTCCCACTATGGGG - Intronic
1050922366 9:11220351-11220373 GGAGCAGACTTAGCACTATGGGG + Intergenic
1054761572 9:69009509-69009531 GGTCCAGAGCAGCCCCTATGTGG + Intergenic
1055859391 9:80730293-80730315 GGTCCGGAGTTACCACTACGTGG - Intergenic
1062727507 9:138083899-138083921 GGTCTAGAGTAACCACTACATGG + Intronic
1186270818 X:7886339-7886361 GGTCCAGACTTACCATCATATGG - Intergenic
1186637554 X:11422696-11422718 GGTCCAGGGTTATCACAATGTGG + Intronic
1188988148 X:36786322-36786344 TGTCCAGAGTCACCACTATAAGG - Intergenic
1194130526 X:90075073-90075095 GGTACACAGTTACCAAGATGTGG + Intergenic
1196515188 X:116602618-116602640 GGTCCACTGTTAGCCCTATGGGG - Intergenic
1197778404 X:130136152-130136174 GGCCCACAGCTGCCACTATGTGG + Exonic
1198703699 X:139423960-139423982 GATCCTAAGTTACCCCTATGTGG - Intergenic
1199243466 X:145575232-145575254 CCTACAGACTTACCACTATGTGG - Intergenic
1201231688 Y:11871006-11871028 TGTGCAGAGTTTCCACAATGGGG + Intergenic