ID: 954943253

View in Genome Browser
Species Human (GRCh38)
Location 3:54394031-54394053
Sequence CAGAGTTACCACTATGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954943245_954943253 22 Left 954943245 3:54393986-54394008 CCATACAGGGTCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 91
954943250_954943253 -10 Left 954943250 3:54394018-54394040 CCATCTGGGGGTCCAGAGTTACC 0: 1
1: 0
2: 1
3: 12
4: 128
Right 954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954943253 Original CRISPR CAGAGTTACCACTATGAGGT AGG Intronic
902820729 1:18941738-18941760 CTGAGGTCTCACTATGAGGTAGG - Intronic
906545987 1:46619833-46619855 CAGAGTTCCCACTGCGAGGGGGG - Intergenic
907116644 1:51974779-51974801 CACAATTAACACTATGAAGTAGG - Intronic
908163024 1:61430242-61430264 CAGAGTACCCACTATGTGCTGGG - Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
912968686 1:114259988-114260010 CACAGTCACCACACTGAGGTGGG + Intergenic
913195199 1:116450532-116450554 ACGAAGTACCACTATGAGGTGGG - Intergenic
915774355 1:158466289-158466311 AACAGTTACCACAATGAGATGGG - Exonic
916242340 1:162652638-162652660 CTGAGTACCCACTATGTGGTAGG + Intronic
916572247 1:166038085-166038107 CAGACTAACCACCATGTGGTTGG - Intergenic
916882391 1:169032533-169032555 CAGCGTTAACTCTATGTGGTGGG - Intergenic
918388675 1:184036712-184036734 CAGGGCTAGCAGTATGAGGTGGG + Intronic
1064757681 10:18586740-18586762 CAAAGTTTCCACTATGTGGAAGG + Intronic
1067714390 10:48678085-48678107 CAGAGTCTCCACTTTGAGGAAGG - Intergenic
1074885970 10:117693910-117693932 CAGAATTCCCAGGATGAGGTGGG - Intergenic
1075933917 10:126323468-126323490 CAGAGTTGCCAAAAGGAGGTAGG + Intronic
1078035156 11:7796205-7796227 CAGGGTAACCACAGTGAGGTGGG + Exonic
1083257698 11:61506725-61506747 CATAGTTGCCTCTGTGAGGTGGG + Intergenic
1087584238 11:100098008-100098030 CAGAATTACCAAGATGAGCTAGG + Intronic
1087867540 11:103249695-103249717 CAGAGTGACCTCTCTGATGTTGG - Intronic
1088089854 11:106024946-106024968 CATAGTTACCATTATTTGGTGGG + Intergenic
1091022875 11:132116559-132116581 TATAGTTACTACTATGAGGGTGG - Intronic
1095756317 12:45770735-45770757 CAGAGGCACCACTCAGAGGTGGG + Intronic
1096392556 12:51240283-51240305 CAGAGCTACCAAAATGAGGCAGG - Intronic
1096491159 12:52013867-52013889 TAGAGTTTCCAGTCTGAGGTTGG - Exonic
1105790583 13:23794376-23794398 CAGCGTTAGCAATATGAGGAAGG - Intronic
1107207377 13:37808933-37808955 GAGTCTTACCACTATGATGTAGG - Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112449948 13:99499226-99499248 CACATTTACCACTATCAGGAAGG - Intergenic
1114152573 14:20060769-20060791 CAGAGTGACCACAATGATGTGGG - Exonic
1117551196 14:56838276-56838298 CATAGTTACCATTGTGTGGTGGG - Intergenic
1117651359 14:57909232-57909254 CAAATATACCACTATGGGGTGGG - Intronic
1128741746 15:70088762-70088784 CAGAATTACCAATATGAGAAAGG + Intronic
1130831820 15:87608702-87608724 CAGATTTTCCACTATAAAGTGGG - Intergenic
1131015008 15:89050770-89050792 CTGAGTTACCCCCATGAGTTAGG + Intergenic
1137622127 16:49883060-49883082 CAAGGTTACCTCTATGAGGATGG + Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138264531 16:55651058-55651080 CAGGGACACCACCATGAGGTGGG + Intergenic
1138555731 16:57770308-57770330 CTGAGTCCCCACTGTGAGGTGGG + Intronic
1150493300 17:65589071-65589093 CAGGGTTCCCACAGTGAGGTGGG - Intronic
1152995526 18:402811-402833 CTGAGTTACCACTTTGGGGAAGG + Intronic
1156976578 18:43228893-43228915 CAGAGTTTCCACTATGCTCTGGG + Intergenic
1158190819 18:54826699-54826721 CACAGTGACCACTGTGAGCTCGG + Intronic
1158932956 18:62338974-62338996 CAGAGTTGCCACTTTGCTGTCGG + Intronic
1163889745 19:20000246-20000268 CAGAGTTGTCTCTAGGAGGTGGG - Intronic
1168703815 19:58456773-58456795 CAGTGTTACCTCTTTGAGGATGG - Exonic
926441839 2:12897260-12897282 CAGAGTTAAAATTATTAGGTAGG + Intergenic
929405157 2:41633360-41633382 CAAAGATACCACTCTGAGGCAGG + Intergenic
938686049 2:133738939-133738961 CAGAGTTACTAAAAAGAGGTTGG - Intergenic
939629091 2:144513408-144513430 CAGAGTTTCCACTAAAGGGTTGG - Intronic
940764759 2:157778300-157778322 CAGAATTTCCACTTGGAGGTTGG - Exonic
1170127840 20:12985693-12985715 CCCAGTTACCAGTTTGAGGTTGG - Intergenic
1173428692 20:42966557-42966579 CAGAGTTTCTACTATAAGTTGGG - Intronic
1175999935 20:62827192-62827214 CAGAGTTAACACCATGGAGTTGG - Intronic
1181961074 22:26622205-26622227 CAGAGCTACCTCTTTGAGCTAGG + Intronic
1184405324 22:44297568-44297590 CAGAGCTACCACCGTGAGGTGGG - Intronic
950923703 3:16719299-16719321 CACAATAACCTCTATGAGGTTGG - Intergenic
953735644 3:45491871-45491893 CAGAGTTAGCACCAGGAGGGAGG - Intronic
954237073 3:49265104-49265126 CAGAAGTACCACTCTGAGGCTGG + Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955811069 3:62790243-62790265 CAGAGATACTACTATAAAGTTGG - Intronic
960045765 3:113196355-113196377 CAGAGTTGCCTCTATAAGCTTGG - Intergenic
963841036 3:150106653-150106675 CAGAATGAACACTGTGAGGTAGG + Intergenic
966571624 3:181450450-181450472 CACAGTGACCACCATGATGTAGG + Intergenic
969870782 4:10103378-10103400 CAGAAATGCCACCATGAGGTTGG - Intronic
979470651 4:121092189-121092211 GAGGTTTACCACTATGTGGTGGG + Intergenic
981382791 4:144092502-144092524 CAGAGTTTCTTGTATGAGGTTGG + Intergenic
984262203 4:177455554-177455576 CAGAGTTTCCACTGTGAAGCGGG - Intergenic
986355085 5:6915978-6916000 CAGATTTCCCACTATGATGGTGG + Intergenic
991578669 5:68131514-68131536 CAGAGATACCTGAATGAGGTAGG - Intergenic
998224913 5:140319473-140319495 CAGAGTTCCTACTATGTGCTAGG + Intergenic
1002126549 5:177049777-177049799 CAGAACTACCCCAATGAGGTAGG - Intronic
1004365412 6:15008647-15008669 CAGAGTTACCATTCTGAGGGTGG - Intergenic
1005665840 6:28053417-28053439 CAGGGAAACCACTGTGAGGTGGG + Intergenic
1005767442 6:29026873-29026895 CAGAATTACTACTGTGAGGTGGG + Intergenic
1006973383 6:38070823-38070845 CAGCATTACCAATATTAGGTGGG + Intronic
1007997681 6:46325916-46325938 CAGAGTTTCTTCTTTGAGGTGGG + Intronic
1009245293 6:61230517-61230539 CTGAGTTAGCATTATGAGTTGGG + Intergenic
1014333719 6:120103592-120103614 CAGAGAATCCACTATGAGATGGG - Intergenic
1014882366 6:126739122-126739144 GAGAATTCCAACTATGAGGTTGG - Intergenic
1020786788 7:12583670-12583692 CAGAGTTTCCACTATGGGCCAGG + Intronic
1022817684 7:33929112-33929134 CAGAGTTTGCACTGTGAGCTGGG + Intronic
1023798815 7:43815239-43815261 AAGAGTTACCACAAGGAGGGGGG + Intergenic
1032444781 7:131972880-131972902 CAGAGTGATCACTAAGATGTGGG - Intergenic
1033681480 7:143600149-143600171 CAGAATCACCACCATGAGATAGG + Intergenic
1033703412 7:143861664-143861686 CAGAATCACCACCATGAGATAGG - Intronic
1034074693 7:148220400-148220422 CATAGTTAACATTATGATGTTGG - Intronic
1038134944 8:24775228-24775250 CAGAGTCATCCCTATGAAGTAGG - Intergenic
1038435750 8:27534862-27534884 CAGAGTTACCCCTTGGTGGTGGG + Intronic
1042191875 8:66195210-66195232 CAGCAATACCTCTATGAGGTAGG - Intergenic
1042994337 8:74678808-74678830 CAGACTTTCAACTATGAGATTGG - Intronic
1044974824 8:97654033-97654055 CAGGGTTACCTTTATGAGATGGG - Intronic
1189100802 X:38187531-38187553 CATAGTTTACACTTTGAGGTAGG + Intronic
1195146103 X:102018762-102018784 CAAAGTTACCACTCAAAGGTGGG + Intergenic
1198301669 X:135339513-135339535 CAGAGCTACCAGTAGGATGTGGG + Intronic
1199900668 X:152168965-152168987 CAGAGCAACCCCTATGAGGTAGG + Intronic
1200476813 Y:3648768-3648790 CCCAGTTACAACTAAGAGGTTGG + Intergenic